Home >

Resource Information


Ref.

Vitis vinifera (Phytozome v10.1) genome sequence

유전자원

유전자원 17개체 resequencing data의 consensus sequence

교배실생

TanoRed X Ruby(seedless)의 교배실생 18개체 resequencing data의 consensus sequence


Get Sequence

Ref.
유전자원









교배실생









 DNA sequence of chr1
scaffolds     total length :
Start (limit 500k)
End
Download : chr1_1_500.fasta


>chr1|Vvinifera|1|500 ACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAACCGTAAAGTCCAAAACGCTAA CCCCTTAACCCTAAACCCTAAACCCTGAACCCTAAATCCCTGAACCCCTAAACTCTAAACCCTAAACCCAAAACCCTATACCCCGAACCCTAAAACCCCA AACCCTAAACCCTAAAACTGTAAAATCCAAAAACGCTAAACCCTAAACCCTAAACTCTAAATCCCTAAGTCCCTAAACCCCTAAACTCTAAACTTGAAGC CCTACACCTTAAACCTTAAATCCTAAATCCATAAATCCCTAAACTCTAAACTTGAAGCCTTAAACCCAAAACCCTAAATCCTATGATCTATGTCTTAAAC CCTTGGCCTAGACCTAAGCCCTATATGCTAAATGATTATAATTTTAAAATACGTTTAATTATATTTATATATATACATAGTATATATTATTATACTTATT

>chr1|Thompson_SDS|1|500 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

>chr1|TanoRed|1|500 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTNAANNNNNNNNNNNNNNNNNNNNNN NCCCTNAACCCTNAACCCTAAACCCTGAACCCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN