Home >

Resource Information


교배실생 GBS

TanoRed X Ruby(seedless) 교배실생 150개체 GBS data를 이용하여 만든 Genetic map


Genetic Map viewer


Chr No


MarKer ID Ref. Tano
Red
Ruby
seedless
Genic
Intergenic
Descript Flanking Seq.
chr4_55704 A M A GSVIVG01035287001
GTTATTCATGTTGAGAAAGGGTCTGACGAAAAGCAAACTCATGATTGATCTCTGCCAAATCATCATGAAATGCGGCAAGATCCTAGGGAAGGAGGTGAAC
GAACTCATGCTCCGCCATCACACAACCCTCGATTCCCTCAGCTGCCGCTCACGTGACCTCCACATGTCCTTCGTTTCCCCTCACGATTACGAGTTCAGTT
GCAGCAACAGCCCCGCCTACCCCTTCCACCTCACCAAGCGCAAGGCCCATTTCACCTACACCTTCAGCAACCGCCCCCGCCATCATTACGCCCGCTATC[
A/C]CGCTCCCACGGCGGATAACGACGTTGCTGCGGTGACTGTCATGAAGACGATGCTCGAAATGTTGAGTGGTGATGTGGCGGCGTCGCCTTTGATGGG
AGCGGCGTTCGGGCGGAGCCCAGTGGCCGTGCGGCAATTGAGGGTCACTGACTCGCCCTTCCCTTTGAAGGATGATGACGTGGACTGCCACGTGGACAAA
GCTGCTGACGAGTTTATTGAGAGGTTTTACAAGGAGTTGCGGCGGCAGAAGTGGAAGGCTGCGCAAGAAGCAGCCTATTATTATGGTTGATGTGTTCTGG
TCAG
chr4_1847860 T Y Y Intergenic
TAGTTGTTATTGCTTTTGATGCCATAACTTAGGTGCATTGTTATGAATTTTTGCTTTAGTTTTCACATGTAACAATGAAATCACATATGCTTTGTGTGTT
ACAGTACCCAATTAAATTTTTAATTTCTATGGTCTCTCTCCTAGCCACTGAAAAAGGGTAAAAAAGAAGAAGAGATCAAAGAATTTCCTGGATATCTATG
TTGACTTACCGATACTGGGCTGATTGAACATCATAGGAAGATCTGCAGCATATTAGCAAACTGCAGCTTAAATATGCCTGCTAACTGCTTGGCAGATTC[
T/C]GTGAGTGTACTTCATTCTTCATCACTAATTTTACTTCATCATGTACTGATAAAATGCATTTAGTCTTTGGCAATAAGGCTCAGGCAAAGGAATGAG
GGAAGCTGCAGTTCACGGAAAAGCTCTAGACTCTGTTTATATTTGGGTTCTACACTCGATACTCTGTTTGCAAACTACATTGCAGGAACCCAGTTAATCC
AGAGTCACATAGAAATGGCAGAGGACAAAAGAGGATAATCGGCCCTCATGGGCTGCATTGTTTGAAGCCATCCTTGTTCTGAAGCCCAAGCTGGGTGTAT
TGAC
chr4_2009468 C Y C GSVIVG01035523001
ATCCTTGATCTGAGACAACCCCTCTTTCATGGCCTCCAGCTTTGAGACATGTAAAAGTAGTCCCTTCTCAGCAGTTCTTAAACACTTGAGGAGGTGGTTG
AACATCACCAGAACTTCTCCCCATTTACGAGAAGGGGATTCGGGTGCTCTTGCAGGCGCAGGCCGCATCCATGAAGTAGAGTCAGGATCATAGGAAATGG
CCTTATCAGCTAAGAAATTCAGGCAGCTCAGGACTATTTGCTGCCCCATCATCATCCCTTTGCCTGGAGGATGACGTTGATGATCCAGAGACTCCATCT[
C/T]GGATTTCAATCCATTCAGTATCTCCTCCAGCGCACCCACCCATATCCGATGCTGTGTGACTTGTGAGCATACTGTGAAACGTACTTCCTTCCTTTG
CTGAGCAGAAATGTTCAAGAAGTTGCAGACTTTAGTCAGTGAATTCACAGTCATGGGCTCCCTTTCATTCGGTTTACCGAAACAATCAGGCAATGTGCAT
TGCCCAGCTGCCAGTGATGCCATATTCTTCTTCACTGCTTGCTGCATCAATGGAGACCCAAGAAAAGCTCGAGCGAGCGACTTGAAAGTCTGCATTCTTT
GTTC
chr4_4199905 C M M Intergenic
AAAGCAGCCTAACTTGAAATCAAAAAGCTAGAACAAGCACAGGTGGGTCATGTCATGCTGTTATGTGAAGTACAATATGGGTCACAAGAACCACAAAGTA
GTACAAGTCGGCTGATATTGAAGTACAGGCGGTGCATGTTAGCAGAAACCAACAAGAACACGCTAAAATGGACCAGACGATGTTTGGCAGCTTTGGCTCA
CCAAGAAAATTGAGCTACCACCTAGCAGACTAGTGGAACGAAAGGGAAAGTAGCAACAATATTGAAACAAATAAGTGGGTTATGATGCGCAGCAATAAG[
C/A]GGTGAACATGCTAAGATGCGCGGATAGAGGGTTGACTCACCATGAAACTTGATCAGTTTTAGTTGAGCTTCGAGAAGATGATGGGCTGGACCCAGA
TGGTGGAGGCGAGAGATTTAGGCAGCAACCAGCAGAGAAGGCCATTCTCTCTCTCTCTCTCTCCCCCAAATTTTGAGGAGAGGGTGATTACATATATAGA
GCAGGGGTGTTTGGGCAAATTTTCTCGGAAGTTGGCCAGCTCAAGGTGGGTGGGAAAGACGCCAACGATGGCCCTTAGTGTTCAAACACGTGGGTTGGAC
CCTC
chr4_4501570 G G S GSVIVG01035802001 Cytochrome bd ubiquinol oxidase, 14kDa subunit
GCAAGGATGGGCTTAGACTTGGAGTTTTAGAGCATAGATGTCATTTGTCAACACATACCCTGCTGGTTATGTAGACAATCACCAGAAGCACTTGTCATAT
ACAAGATGCCACAATTTGTAGTTACACATTGCACTTTTGATGTTGAATTGCTTGCTCATTTAGTTTAGCAAGCAGCATGCTTTTCTTAGCAATTTATTGT
GTGATGAAATATAGAATTGAACGTTTGAGGAAACTACTAATTAGAGCTCAGCTGCAATGCAGGCGGAAAGAAAAGAAATGCTTGGATCTTGTTTTTACC[
G/C]TTGTAAGTCATCATGAGTAATAGGCAGTGTCAAGTCAAAATAAAATCTCTTGCTGCTTTTGTTGTGCAGGTAAAGAGGGAGAATGCAGAACGTGAA
GCTTTGGGAGCGTTGCCCCTCTACCAGCGAACTCTTCCCTGAGCATCTGCCATCTACCGCAGCTATTCACCCATTTGAGTATTATCTTTAAATGAATTTA
AGGATAATGGTTTTTGGTTCCTGGAGGAAGTTGAAAGGGATTGTCCGACTGCTTCAAAAGTTTATTTTCCTTATTTAATTTCCGATATTGAATGGTTTTT
GGTA
chr4_4554977 C S C GSVIVG01035810001 Tetratricopeptide repeat (TPR)-like superfamily protein
CCAGGATGTCAAATTGCGCTCTGGCATTTTCTTAAACACTGCATATGCATCATCCATGGAACCACATTTTGAATACATCTCTAGGATCCTGTTATAAGTA
CTCACTTTGAGAGGGGATACTGATTTGATAAGGCTCTCGTGAACAGCTTTTGCTTCTTGTAGTGCTTTAGCCTCCCCACATGCCTTCATTAACCGCAGGT
ACCTGGGCAAATCCACAGGAGTGTGCTGCTTCTCCAACAATCCCAAAACTTCTATAGCTTCCTTTACTTTTCCATCCTTGCAGAAATCATCCACCTCCT[
C/G]AAGAGTGCCACTATATTGGCTACTCTCTGCAGCTTCTAAAGACTCTCCATCTGGTTTGTAATTACTTGATTTTGGAGAACCCACCATGCTATTCTG
AAACTCATTAGAGTTTGTTTGATATTGAGCAACATTTGGGTTCTGCTGATATTGAGCAACATTTGGGTTCTGCTGATATTGAGCAACATTTGGGTTCTGC
TGATATTGACCAATATTTGGGTTCTGCTGATATTGACCAACATTTGGGTTCTGTTGATATTGACCAACATTTTCTCTATAGTACATATTCTCACTTGGCT
GATA
chr4_5067251 G G R GSVIVG01035869001
GCCCTCTTCGAATTCAACCTCACCCTTCCCATCATGATGGCCCAGTTCCTCCTCCTCATGGTCGCACTCGACAAGATCTACTACTCTCCCCTCGGCAAAT
TCATGGACGAAAGAAACGCCGCTATCAAGGAAAAGCTCAACAGCGTGAAGGACACTTCCGGCGAAGTGAAGCAGCTGGAGGAGCAGGCTGCGGCTGTGAT
GAAGGCGGTGAGGGCGGAGATATCGGCGGCCCTCAACCAGATGAAGAAGGAGACGGCGGCGGAAGTAGAGATGAAGCTGGCGGAGGGGAGGAAGAAGGT[
G/A]GAAGCGGAGCTGCAAGAGGCTTTGGCCGTTTTGGAGAAGCAGAAGGAGGACACCATCAAGGCTCTTGATTCTCAGATCGCTGCTCTGAGTCAGCAA
ATTGTGAACAAGGTCCTTCCCCTCTGATCTTTTTTTTTTTTTTTTCCTTTTTCCAAATTTAATTTTCATGGCCATCATGGGAAACAAATTTAATTTCCTA
TTATAATGGATTTTGTGTAGCATATATATAATTGCAATGTAACCATCTACCCATGTGGAAATTTTTGGGGTCACTTCCAAATGAATGACAAATATGGGTT
GATG
chr4_5225959 T C Y GSVIVG01035882001 sucrose phosphate synthase 2F
ATTTTACTTTAATTGGCAGGCATTATGTCAATCACATAGCAGTACAGCATATTCATCTTTCATCTCAATGATAAAATGCATGACACGAGGGACAGATATG
TGTGCAGTGCAGAGAAATGTAATGAAATTCATGACCATATCCATACTTCACCCTTGGGTATAGAGGTGCAGCGGAAGGTGGGGATGAACTAAAAGGACTC
CATGGTACATCAGACAAAGGTGCACCAGTATGAGATGGGTTGACACTATCCAAATGTAAATTTCACAATTCACACAACAATGGCAACCAGGATATATAC[
T/C]TGTGCTTATGTGGTATTATTTATTGAAGTACAATCCTGTTCTCAGTATCACAAAGAATACCTTTGTTTTTGCTGCCAGATGGTAAATCTCAGGAAC
TTCAGACTGCTTGTGATGTTTAGGATAAGCCACTTGGCCATACATATCATATTTGTCAATCAGCTTAAGTATTGAAATAAGAACAGATGCATTTGTGCTA
GACATTTCATCGATGTCATCACGGTTGCCCATTATTAATGTCTGCAACAGTAGAAATTGCAAAATCACTGGCATAGAACCCCAAAGAAAAAATGAGCCGT
TTCA
chr4_7024752 A R A GSVIVG01036005001 zinc finger (CCCH-type) family protein / D111/G-patch domain-containing protein
CTGCAGAGGGGCATCCAGACAGAGACTGCCATTTTTGCCAAGTGGGAGAATCACACCCGTGGAATAGCTTCCAAGATGATGGCCAACATGGGTTACCGAG
AAGGAATGGGTTTAGGGGCATCTGGACAGGGAATCGTGGACCCTCTCTCTGTGAAAGTCCTCCCACCAAAGCAATCTCTTGATCATGCCCTTGAGTCCCA
TGAAAACGAGGAGAACAAAGAAAGTAGGGGGAAGAAGCGGAGTAGAGGCGGTAAGAGAAAACGTGATAAGAAGTTTGCTGCTGCAGCTCGGGCTAAAAA[
A/G]GATAAAGAAGAATCAAGACCAGATGTCTTCAGCCTCATCAATACCCAACTTGCAATGCATGGAGAAGCTTTGAATGGTGGATCAGCAAAGAAGCAG
CAGAATAAAAGTTTAGGGGAGGGGAAGAAAGAAGACAGACGGGCTCTGGTTGCCTATGATGATGAAGTGAGGGAATTGAGAATTCGAGTTGAGAAGCTGG
AAGAAATGGTGAACCGAAACAAGAAGGAGAAAGTAGTTTACGAGGCTGCCATGAGAAAATTGAATGAGACTCGCAAAGCTTTGGCAGAGGCCGAGGCAGC
TCAT
chr4_8005927 A R A Intergenic
TGTGGGCTCCATGGTGGCTGTGTGAGTTGTGCGGGCTATGTGGTGGTTGTGTGAGCTATGTGGGCCGCATGGTGGCACAAATGGGAAGTGGTTGGTGAAG
ATTGGCAGCTTTGGGACTAAAGTCGGATGGTGTTTCAGTGGTGGAATGAGTGAAAGAAGTAGTGAGAGAGGTGGGTTTGGTAGGTATAGAAAATGAGGAT
ATGAATGGTGATGGGTATGGGAGGCATGAAGAGTGGCCATGAGTGCATAAATCCTATGGGCATGGGTAGGAAATGGGTAGTAGGGCAGCAGGTTGGGCA[
A/G]GTGTGAAGGAAGTAGGAGGTGAAAGTGTGGTGATGTGTTTGGTGGATGGGTTGAAGGTAATAGGTATGGAAATGAAGGTGGCCACACGCGTTAGAC
TCCATGTATGTAAGAAATAATGGAAATAAACTGAAGGTGGATTAGATGGTGTGGTTGGGGAGCATGTGGGTTGTGTGTGGTGGCTATGGGGTGGCTGTGG
GCTGCATGTGCTGGATATGATGGTCATGGGGTGGCTATGGGTTGCATGTAGTGGTCATAATCAGGATGATGGGGGATGATGGTGATGTAAATGGGGGAGT
AGTT
chr4_8598176 T K T GSVIVG01033155001 glutamate receptor 2.7
ATCATATGGTTATTTGTGGTGCTGATTCTTACTCAAAGTTACACAGCCAGCTTGACTTCAATGTTAACAGTTCAACAGTTCAACAGCTTAACCCAACTAT
CACTGATATAAATGAGCTCATAAAGAAGGGGGAGCGTGTAGGTTACCAATATGGCTCTTTCGTTTATGAATTCTTGATCAAGTCGATGAAATTTGATGAG
TCCAAGCTTGTAAAGTATGAGTCACCAGAAGAACTGGATGAATTATTTTCAAAAGGTGGAATTGCTGCTGCATTTGATGAAATCCCTTACATGAAGGTT[
T/G]TCCTTGCAAAATATTGCTCCAAATACACTGCAGTTGGACCAACATACAAGTTTGATGGGTTTGGATTTGTAAGTGTTCTCTCTTAAAGTGTACAAA
TTTTCATGCAGCGGTTTCTGATTTTTTATCATTTCAGGTCTTTCCAAAGGGTTCACCCCTTGTAGCGGATGTTTCAAGGAAAGTTTTAAGCGTGACCGAG
GGAGCTAAATTGTTAGAATTTGAGAAGGCATGGTTTGGGCAAACAACCAGTTGTCCAGAGCTCACCAGCTCAGTTTCTTCAAACAGTATCGGCCTTAATA
GCTT
chr4_8891149 G R G GSVIVG01033170001 cyclic nucleotide-gated channel 14
AATCTAGCAGTGTTCAACTAGTAATCATCTGGCTCAATCGAGAAGTCTGGCTCTTCAGGCTTCTGCAGCTTGGGCATTTCAACATCCTTGACCTTTTGAG
CTCCTCGCCTTGTGTTTTTGGCAAACCTTGAAGCCAGTATGGTGACCCCTAGATGCTGCTTTGCCTGAGAAGAATTTGATTTTGTGGAGCTCCCTTCATC
CTCTTGTTCGGTTTCATCTTCATCATCTGCATGGTCATCGTCATCAGCAAAGGAGAATGACTCTCGCATGCTGAGGTTCTTTGCCATTATCCGCTTCTT[
G/A]TACCGGCGCCAAGCAGCCTGAATGAAGCAGGCTGCCCAGGTCCTCCAGTGGTGAGAGTAGAAGCGGAAAGTGTGCTGCAGCTTCTTACTATGGAGA
CGTCTAAACTGATTTGCAACAAACTTGAGATCCTCTGCTCGCAGTGCAAAGGCTTCCACCTCAACAAGGGCTCTTACTGTTCTTGTTGAAGAGGGCAAGT
TCTGAGTAATTTTGGGAAGTAATGCCCATGCAAGCAACTCCTCCCCGCAAAAATCGCCTGGCCGTAAAGTAATTGAATTGAAGAAACCTGTTCTGCCTCC
ATTC
chr4_9660945 C Y C GSVIVG01033203001 Transcription factor jumonji (jmjC) domain-containing protein
ATACAAAATAGTTGATAACTATATAAAATAAATTACAACTAATTGACAACTACACAATCAGTTGCACACAGCTGTACGCATGGCTATACATCACAGCTAT
ACATCATAGTTGTACCCACAACTGACTCTCCACCTCAAGTTGGTGCATAGATATTGCACATGCCCAACTTGGATAATGCTGCATACAATCGGCCATTAGT
AACTACATGAGTTATCATATTCACTAACTGATCTGCCCCTCTTAATGGGATTATCCCATTAGATGTATGCAACTTTTACCTGACATTAACAACAAGAGC[
C/T]GTCTCGTTAACAGAACCATAGGAAGGATTATGCGCTCAGAAGAGTCCAGTTGATAAAGCGGGGCCTGCTGCTGCTGCCATGGCAAGAAAGCGTATG
GGAAAGAAAGGACTGGACTGACAGGAGAGGGAGATTAAGAAGGTAAAACTGGAACGAATTATTTGACCTGATTGCTTTGTCTGTTTTCAAGGCCAGAGAG
ATTATAATTGTTCTAGACTCTTGAGGAGCGCTAGGAACTGTATATATCAAAGGTCAGGGGTGGCAAAAAGGACTTGTCTGGTTGAATCATTCAAGCCAAC
CTTA
chr4_11092849 T Y T GSVIVG01035239001 ARM repeat superfamily protein
ATGAATACAAACCATATTCTCTGGTATTGTTGTATCTTGGTTAAGAGGAAGTCAACTAAATGGATAATGAGGCTTCCTGGTTGAGGCCAGAGCAAAGCAG
CTTGAGAGGAAGGTCTTTAGGTGGAGTGATGCAGTGTATCCCAAGCATGGATTTCTCTCAGTAGGATTTCCAAACTGAGAGAATCAATAGTCTGGATTTG
AGGTTAATTCCGCTCCAAATGAGTTACCTTTAGCCTTACATAAGGATCTGAAAAGAATGCAAGCAGCTTGGATATAATTTTAATCCCTGGATGCTTGGT[
T/C]TGTTTAGGGTCCACTAGCTCAGAAGTGTAGAACTGTACAACTAGCTTACAGCTATATTGGCAGGTTTTGTTGCTGATGCAGTGCTGCCATGTTGAG
GGTGGCACTCATCCTAGAGCCTTTGACAAATCCTTATGTCTTAAGTTGGCTGAAAGTCTTCTAATATGTTTTGTATACACCTGGTTACACACACCTTGTC
TATCCAGAGCCAATACCCCAGGCTATCCCTTCGGTTTAACATTCAGGGATGATTGCATCATGAACTAGTGCAGAGTTTGTATTAATACCCCAACCTTCCC
TTCA
chr4_11452728 G R A GSVIVG01035253001 SET domain group 40
TGCAGCAATGAGTTATCATTAGGGTTTTTTTATTCTTTGTCCTTTTTGATAATTTTCTTGAGCTTCTAATTGTTTTTAGTTTCTTGGACTATAAACAAAA
TGCTCAAAATAACACAAGAAAGTCATAAATAATGAAACCGATCATCCAAAGGGCAACAGGAAGCTATCATACTACATAATATTTGCTTTCAGGAAATCAA
GAAAGTTAGCAATACCTGCTCTCCTTTTTTATAATTTTTCCTAGCATAGAAGCAATATGCAGCAAGATCTTCCTTGTAGCCCCCATCTGTTAACCTCTG[
G/A]GAGAGAACATCATCTTGCTCTGCATCTGAATTGCTAGTAGCATCCTTATTCCAGAAAGAACTATCTTGCAAGGAAGATTCATTTCTTGAACCCTTC
AAATCTTCCCAGCCACATGGTTCTTCTCCAGGGGCAGCATAATTGTAGAAGTCCCCAACAGGGCATAAACATCCAGCGTCATCCCATGGTATATGCATCG
TGCGTGAGGATACCTTCAAGCATATTGAAGTCCAAATGTTTTTACTATTGCCAGTAAGAAACAGCATAAAAAGAGAGAAACACAAGTGTAGAATGGTACA
TTGT
chr4_12174593 T Y T GSVIVG01001480001 Haem oxygenase-like, multi-helical
AGAAGTGGATTGACAACTATTCTTCTGAAGGTTTCCAGGTTTGTACTTAGCAGTGAGCATTTTTATTTTATTTTAAAATTGTCTAACTGTAAATCTCTGC
TGACGCCATTCTGAGAGAAGTATACTTTACATAAATGGTTTTCTCACTCAGGCAGCTTAACTAACTTGTTCTTTGAATTTAGGGTTCAGCTTTACAAACT
GAGGACTTGCTGGATAAACTAAGTGTCTCTTTGACAGGCGAAGAGCTTGACATCATAGAAAAGCTTTATTACCAAGCTATGAAACTTGAAATAGAGTTC[
T/C]TCTGTGCTCAGCTGCTTGATCAGTACACTATAGTTCCTCTAACTAAAGGGCATGACCCTGCAGCAGATCGTCTTGTGATATTTTCTGATTTTGATT
TGACATGTACAGTTGTTGACTCTTCTGCCATTTTGGCAGAGATTGCAATAATAACAGCACCAAAATTTGATCAGAATCAACCTGAAAATCAAATTATTCG
GATGTCCTCAGCTGACTTGAGGAACACATGGGGTGTTCTATCCAAGCAGTATACTGAAGAGTATGAGCAATGTATAGAAAACATTCTGCCATCTGAGAAA
GGTA
chr4_12232042 A M A Intergenic
AGTCCACACACACCCCATGGCCACCATATGCAACCCACACCTCCCTCACAGCACATACACAACCCATAGGTAGTCCACACACACCCTATGGCCACTATAG
CCACCACATGCAACCCGCACCTTCCTCACAACACACACACACACAACCCATAGGTAGTCCATAGGCACTCCATGGCCACCATGGCTACCACATGCAGCTC
GCATCTTCCTCACATCACACATACAACCCATAGGTAGTCCATAGGCACCCCATGGCCACCACATGTAGCCCGCACCTTCCTCATAGCACATACACAGCC[
A/C]ATAGGTAGTCTACATGCACCCTATGGCCACCATGGCCACCACATGCAGCTCGCACCTTCCTTATAGCTCACCCATGCATACCTCACCTTCACACGC
TCACCCACATGCAGCCCACACACCTCATAACTCACCCATGGTCTCCACGGCTCATCCAAAGCCACCCCATGCATCCCCATCTCACCACAGCTCACCCATG
GCCTCCTCACCACCACCATGCACCCACAACCACCCTTAAGGCCACCATATAATTGATCTTTGGTAGTTGAATTTTTTATGAAGAGTTATGAAATTTGTGG
CTGT
chr4_13019589 A W A Intergenic
GCTAAAGAGCTAGAGTCTATTTAATTGACAAAACAAAATTTCTAAATTGGTGGATTCATCCTCCCCCAAAGGCATAAAGAGGAAAGTCTTATCCAGAAAC
CATGGAATCCGCCCCTCTTAACTAACTTTCAGAAATGGGAAAATCATCGAAAAGCAGCCAGAGAAAAGCTTATCAACTATTTGCGAGAAAAGTCATGGAG
GTTTCCTCCGAGAGAACCTCAAACTGCTGACTATTTGATTTGTTGGACTTTGACTATGACGATTCAGGCGAACAATGGGGAAAAGAGCACATGGTTATG[
A/T]CAGTGAATAGAGATGCATGTGAGTGGGCGGTGGGCGCTGCATGTGATCACGTTGGCCTATATTCATGAAATGTTGCTTTCATCCAGTGCTACGCCT
GCCAGCACTGCCACATGCTGCTAATTCCTTCTGGTTTTTCTTGAGCTGGATTTTATAATTCCATCGCTCCATGTTAAAACTAAAATATTTTAAATCACAA
TACGTTTCCACCATTTGAATGCCTTCCGTAGTACAAATGTGTTGGACAGTATAGTTGGAGTAATGTGTATGAAAGAGAAATACACAATACCACTTTCCCT
TTAA
chr4_15481952 G G K GSVIVG01026388001 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
CATAACAATATCCTTCTACAATGAGAAAGAGACATGCATTATTAGACCCAACAGAGTACGTAATTATATTACTAGTCTTCCTCCAGCGCCAAACCAGGCT
CCTGCAGTACGAGTTGAGCCTTTTCCTGAATGAGCTTCCATAGACTATCAACATGCCTAATCTCAGTCAATGTGGACCCAATTGCACAGCGTATGATATA
AATCCCACCCACCACTGCATGAGTCATGAATGCAGCACCACTTCCATTGACAGCCATTAGCAGCCTTGAGTTCAGTTCTGTGCCCTCCCCTTCTTCTCT[
G/T]GGCCTCAGTCTGAAGCACACCAGTGCAAACCTTCTCGGCACCACAACCTCAAATCTGGGATCTGTGGCTACATGTGCCTCGAATCGCTTGGCCAAG
TTTACATCGCTGCGTATATGGAACATGAGGTTGTCCAAGCCATGCCTTCGAATCACCACCCAAACTTTGATGGCCCTGAATCTTCTACTTAGTGCTATTT
GCCAATCTTTGTAGTCTATGACCTTCTTTGATTCGCTTGCATTGTTCCTCAGAAACTCAGGAGCAGTTGATAATGAATCCACAAATAGCTTTGGTTCTTT
AATC
chr4_15703114 A G R GSVIVG01026406001 Protein kinase superfamily protein
TATCAGTTGTCTGAATAATTTCAGGTATGGTTTCAATTTCTGAGAAATTCATACAAGATTTTTACCTAGCCAGAATCATAGTTGGTAATTTTTTTCCCTC
TTGATGACCAGCCTGAAATTTGAGTCTACTCTTGATTTTGCAGCTATGGAAGGAGGAATATACGTGGAAGATTACCTATCCAGAATGATCCAGGTTGCTC
CTAGTTCTCCGGCTTTTGTAGCAACCGCCCCCATCTCTGCATCAGCTAGAACTTCAGCTGCAGTTTGGACCTGTCATCCGATGATTGATCATATAACCC[
A/G]ACAACAATTGTTACAAAACAACACTGTGAGAAGGAAACACCCCCTGTACCTGCTTGACATTGTGGGCTAAACACAGTTGCTGCATCATCTGAACAC
AGACACCGTTGATTCGATTGGATGCATCATCCTGAGCTCTATTAACAAGGCCCGCCTGATCAGATGTTGAACTCTCCTCCTGCCTAAGACCCAGTTTCTT
TAGCAGACCTGAAGCAACAAAAAGAATCAAAACATGGAAGACATGGCTAACAAAACTGTCCAAACCAAGCAGAAAGGAGAAATGGAAACCTACAAGAAAG
AAAC
chr4_18050520 C Y C GSVIVG01018987001 Protein of unknown function (DUF620)
GTCAGATTGGACAACTCCGTCCACCGTCCCATCAGAGATAGTTCCATTGTAAGAACTAAGAACCTTCCCTTTCAGATTCATCTCCATACTTGTTTTGTCA
TATCGTACGTCATGATTCATGAGTTTGCCATTGACCCACCTGGAGACACGCCGCTGGAACTCCTGCATGGTTGATCTCTTCAATGTCATGCATATTTTGA
GGCATGTAATTCGGGTCTTGGTGCAAGTATGATCAGCAGCTTATTTTGGAACCATAATATTGAATCTTGCAATTTAATTAATCATCTCAAGTCATTGTC[
C/T]TCCATTTTTTAGAACCATTTGAGGAATATTGTTCCTTCTTTCCAGGAAGCTTCCACAGCCAAGTATATTGTACAACAGTATATAGCAGCAACAGGA
GGGCAACCAGCGCTGAGCTCAGTGAACAGCATGTGTGCAATCGGACAGGTGAGGATCAGTGCATCAGAGTTTTACCAAAGCGACCTACACGTGAAGGTGG
GTACTACTGAAGAGATCGGAGGATTTGTGCTTTGGCAAAAGAATCCGGATATGTGGTGGTTAGAGCTCGTTGTGTCAGGTTGCAAGGTGATATCTGGTAG
CAAT
chr4_18065690 A G R GSVIVG01018985001 plant-specific TFIIB-related protein
TTCGAGTCCACCGGCTTCATCTCCGCCTTCTCCACCTGGTCCCTCGACCCATGCCCAATCTTCGCCCGCTCGTGCCTTTCCTTCTCAGGCCACCTTGCTG
AACTCGAGCGTGTTCTCGAATCATCATCATCGTCATCATCGTCATCTTCTTCTTCTGCTGCTGCGGCAGCGTCGTCTTCGTCTCTGGCCTCCTCTGGACC
TGCGGTTGTGGTCGATAATCTTAGGGCTTATCTGCAGATCATAGACGTGGCCTCCATTTTGGGGTTGGACTATGATATAGCGGACCACGCATTTGAGCT[
A/G]TTCAGGGACTGTTCTTCGGCTACCTGTTTGAGGAATCGCAGTGTGGAGGCTCTTGCCACTGCTGCTCTTGTTCAGGCCATTAGGGAGGCCCAGGAG
CCCAGAACTCTTCAGGTCTGTCTCTTTTTTCATTTCGTTTTATTATTATTATTATTATTTTTGGGTGCTTATCAAGCAATCTAAGACTGGATAAGTTAGG
GTTTTGATTTTGTGTTGCTATTTTTCTTGTTGAATTCATCATAATGCTTTAAATTTCTTTGTTTCCTTAATTTATTTTACTTTGATTTCTGTGATATGGA
GTTG
chr4_18532146 C C Y GSVIVG01018938001 Galactose mutarotase-like superfamily protein
GGTAGTGGAAGTTCTCTTGTTCAAGCTGGAGTTGTAAACTCTCTTAGATGGAGTTATGATAACTAAAAAAATTTTGAGTTTTGCTTCTTCCGGTGCTCGT
GGATCCAATTTTGCTCTCTTTGGTTGTGTACTTTGATATTTTGGTTATCTTAAAACATATACTGATTATATCTCTGTTGACAGTGGAGGAATTCCACATT
GTTTCCCACAGTTTGGACCTGGCCCAATGCAGCAGGTAGGGTCCTCCATCACTGTTCCTTTCGCTAGTAATAGCCTTCATTCATCCACTTGTTTCCAGC[
C/T]GTTAGGAGTTAATTGTGTAGCTCATGAGCTGTCAACTACATCATTTTGAGTGGCTGCATAATAATGTCACCCACCAGCTATGCCTTATGGTGATGC
TGCAATCAACGCTTCACCCTAAGTGAGTGCCTTTAGTATATATCCTGGAGGGTCATAATGGAATGTCATGGATCTTCTACATGGATGGTTTGGCCAAAAG
CATAATGGTTAATGTGGTATGCTTGTATTGAATCTAGTGACTAGTAAGCTTGTTCCCACCATTGAGAAATCCTATCTTTTGCAAGTTGTGACAGCATGGT
ATAC
chr4_20020120 G G R GSVIVG01018776001 endonuclease/exonuclease/phosphatase family protein
ATACAATGTGCATGTTTATTGCTCTGCACGTTCATATGAAAGGCTTGGATGTAACCTTCACTTAGTTTCTCCAATAACAGGTGGAAAGGAGGGAGAAGCA
TCAAACTAGAAGGTTCTGATCATGCTCCTGTTTTTATGAGTTTAATGGATATCCCTGATGTTGCGCAGCATAGTACTCCATCTTTGTCTGCTAGATATGT
TCCTACGGTTCATGGGTTCCAGCAAACTATTGGTGTGACGTCTCTGTCCTGTTCTTTGTTTGCATCTGCTTCCTTTTTATACACTTCTCAAATTTTCAC[
G/A]TAGTCACTGTTTTTATGCAGCATCAGTATTAATGAAAAGACAAAAGGCTGAGCAAGTAAAGACCTTCGAGGTATCAAGTTCATTTTCAGATGAAAA
TATTACAACTAGAAGTTGCAGTGAGATTCTGAAAAGATCATCCCAAGACTGCTGTATATCTGACCTGCCTTCAGGCGACTTTCTGTCTTCTTCAAATCTG
CAATCAGAAGGTGTCATTCCAAGACTGGATGGGCCCTCCATATGTTCCATTAGTGATTCTTCCAATAGAATTATAACCGCCTCAATAATCAGGCAAACAA
AATC
chr4_20559077 C Y Y GSVIVG01003838001 serine acetyltransferase 3;2
ATGGAACCATGGGCGTAAAGAGTTGGCATTAGCATTACAAAGTCGGATCAGTGAGGTAGTCTCTTATTTGAAAATCTTTGAATCTGGAGCAGCATTATGA
CCATATTATATGGATTTGTGCCTTTCCTATTTCTCCTTTTAATCTGGTAACCTTTATTTATTTATTTTTGTCTAGGTTTTTGGAGTTGACATCCATCCAG
GTATGTATTTGCTCAAATTTGTTTTATTGGATAGATATCCCATTTACAATTTGTAGCATATTTTTCATTAAGTTTATTGTAGGAGCGAGCAGCAACATT[
C/T]CTTGTAAAAGGGATGTAACTTTTGAGAAACCTATGGTGAAATCAACTTAAATGTGTTTACAGCTTACCTGGTACTTAGATATGATTCTTGTTTCAA
TGAACAGTTGCTGCCATTGCAAGTCTGGAACGATCTTTTTTAACTTGTTGGTTTGTAGCTATGCGAGATGACAAAGGTTTCCTGGATGATATCCACTATG
AGATGAAATTTTTCCTTTTTAATTAAATTTGGTGATTCTGTACAGCTGCACAAATTGGAGAGGAAATACTTCTGGATCATGCAACAGGCGTGGTTATAGG
TGAA
chr4_21086677 T K T Intergenic
AAATTTGATGTATAAATAAATAAGAACGTTGTCCTAAGGCCCAGAGACAAAATTGTATGCCATATTAGACATGGCCGCCTCCCACCATCTTTGAAATAAG
TGAACTCACCATGACCAAAGCAAATGCCCATGTCTTTTCTCCACTTGCGTGTATAAGGTTCCCGTAATCGAATTGGCAATCCAAGACCATACATGGTGGT
TGTAAACATGATTTGACTTGGAGGAAACTTTTTGCCAGCCAAGCTGCCTTTTTAAGAGTTTGCCCTTCTAAGAGTTTTGCCTACGATAGACCGCAATAC[
T/G]CCTGCAAGGAAGTCAGCAAAAGGACCCCGACACATCACTTTGGAAAGCATGATCTAATTGTGGATTGTGGATTGCTCTATCTGACATGATTCCAGC
AGCCGGCAGCTCCACTATTATGAGGGCGCCTCTGTCAGAAATCCCTTTTTGTCTATAAATACTCATATGGTTTGAACCAGAGAGCATCCAAACAGCCTCC
CCAACAGCTTCATTTGCTTCATAGATAGCCATTGGCTTGAGCTATAAACAGCTTTTCAGTTGGTATATTACATGGCTAGTGGGAAGTTTTGGAATGTCAT
GACA
chr4_23096569 T T W GSVIVG01026467001 histone deacetylase 14
TTTAAATCATTAAGCAGGATATTATATCAGCAACTAAATTGCAGGAAGATTTAAACTAAATAATTCATCAAGAGAAATCAAATACCACAAATTGACCAGA
ACCAAAAACTGTAGCTTACTTGATGAGTTGAAAGGAAGAATATATCTGGGTCATCATAGAATGCATCATTTGTTCCATTCCCATGATGAACGTCAAAATC
AATGATAAACACACGCTTTAATCCATGTACACGTTGGGCATAACGAGCTGCAATGGCCACATTTCCAAAAACACAAAAGCCCATAGGACCTTTTGGAAT[
T/A]GCATGATGACCTGGAGGTCTTATCAAAGCAAAACCCATTGGTGGGTCCTGGCTGCTCTTTGATGCTGCTACCTGAGATATGACAAGATTTTGGCAG
ATAGTTTACAGACAAGAACACCAGCATCGAATAATAAAACAATGAAAATAAATTGATTGAATTTCTAAGGAACACAAATGTACAGGATGCCATATTTAGG
AAAGACCAAAATTAAAATAATTTTAACAGGTGAAGAAAAAGAATAATCATTAAGTCACTAACGTGCTAGGTTGAGGCATCACCACTGAATCAACTAAGGT
GATT
chr4_23534544 A R R GSVIVG01026448001 RNA polymerase I specific transcription initiation factor RRN3 protein
TGTCTAGTTAGGTCAAAGATTTTCGTCTTTTCTTTTTGCCTAGCTCTTGGGTGTTGTTTGTATACTTCGTGTGTACTTTTTTCGCCACTTCTAGGCATTA
CTAGTACAAACTTTTATTTACCTATCAAAAAAAATAAAATAAAATAAAATAAGAGCCTCTTTAGGGGATTTGCCATGCAAATGATCTTCCTTGCACTGTT
AGAATAATTTATAATTTACATGTAGCAGCCAAGGCTTTTATTTTTTGTAAACTGATGTGGAGATCACTAGCCACACTTTGCAGGACTGGGAAAAACCAC[
A/G]GTTACATGACCCCTCCCCCTAGAGCTGCATAATGGGTAAGCCAGGCCTCAAACTTGAGACCTCTAATCTGGGAATGAGATCATCTATGAGTTGAGC
TGTCCATGGGGGCAATTTATGTAACTATGGCTTTGTTGGTTTGAAATTAACAATTAAAACAAATAATCTAAGCCAAGGGTCCATATAATTGTATTCTTAG
TTTCATGCCCTCTCCCTCTCAACTTGAATCACCTTTTTCGTGTTCCTTCTTTTGTTATAACTGGTATTTTGGATGCCTTTGAACTATGGATCATGACGTT
TTTG
chr4_23597803 G R G GSVIVG01026444001 hydroxy methylglutaryl CoA reductase 1
TCTTAAACCCTCGGATGCACTGCCACTGCCTCTCTACCTTACAAATGGGATATTCTTCGCCTTGTTTTTCTCCGTGGCCTACTTCCTCCTCCACCGTTGG
AGGGAGAAGATCCGTACGTCAACTCCTCTGCATGTTCTCACCCTCTCTGAAATCGCTGCCATCGTTTCCATGCTGGCGTCTGTTATCTATCTGTTGGGTT
TCTTTGGCGTGGACTTCGTCCAATCTTTGGTCACCCGGCCTTCGGGTGATGTTTGGGACGCGGAAGACGAGCCCCACGGCGCCATCCTCGAGGAAGACA[
G/A]TCGACCCGGGCCTTGCGCGGCAGCCATTGATTGTTGTCCGCCTCCGAAGGTGGCCGATGTTGCTCCTGTGACGGTTTTTTCGTCAGAGGAGGAAGA
GGAGATGATCAGATCGGTGGTGGCGGGGTCTGTTCCATCCTACTTGCTCGAGTCAAAACTGGGTGATTGTAAGAGAGCGGCAGCGATCAGAAGGGAGGCC
TTGCAGAGGACCACAGGGAGGTCTCTGGCGGGGCTGCCCTTGGATGGGTTCGACTACGAGGCGATACTGGGGCAGTGTTGCGAGATGCCGGTTGGGTACG
TGCA