Home >

Resource Information


교배실생 GBS

TanoRed X Ruby(seedless) 교배실생 150개체 GBS data를 이용하여 만든 Genetic map


Genetic Map viewer


Chr No


MarKer ID Ref. Tano
Red
Ruby
seedless
Genic
Intergenic
Descript Flanking Seq.
chr4_55704 A M A GSVIVG01035287001
GTTATTCATGTTGAGAAAGGGTCTGACGAAAAGCAAACTCATGATTGATCTCTGCCAAATCATCATGAAATGCGGCAAGATCCTAGGGAAGGAGGTGAAC
GAACTCATGCTCCGCCATCACACAACCCTCGATTCCCTCAGCTGCCGCTCACGTGACCTCCACATGTCCTTCGTTTCCCCTCACGATTACGAGTTCAGTT
GCAGCAACAGCCCCGCCTACCCCTTCCACCTCACCAAGCGCAAGGCCCATTTCACCTACACCTTCAGCAACCGCCCCCGCCATCATTACGCCCGCTATC[
A/C]CGCTCCCACGGCGGATAACGACGTTGCTGCGGTGACTGTCATGAAGACGATGCTCGAAATGTTGAGTGGTGATGTGGCGGCGTCGCCTTTGATGGG
AGCGGCGTTCGGGCGGAGCCCAGTGGCCGTGCGGCAATTGAGGGTCACTGACTCGCCCTTCCCTTTGAAGGATGATGACGTGGACTGCCACGTGGACAAA
GCTGCTGACGAGTTTATTGAGAGGTTTTACAAGGAGTTGCGGCGGCAGAAGTGGAAGGCTGCGCAAGAAGCAGCCTATTATTATGGTTGATGTGTTCTGG
TCAG
chr4_1207788 G G K GSVIVG01035425001
CTGTCAACTTGATTAGGACTCTTGATTTTGAAGGAGCTGTAGGATTGCATCTATTGAATGCCAGTGATATTGGCAGTGATGACAATGGACTAATGAGCCT
GTCTCTAACATTGGATGAGTGGTTGAGGCTGGATTCTGGAATCATCTGTGATGAGGATCAAATTAGCGAGCATACTTCAAAGATCCTTGCAGCCCATCAT
GCTAAGTGCATGGATCTGGTAAATGGAAGGTTGAAAAGAGACAGAAAATGGGGCAAAGCCTCTGGTAGGAAGTGGGGTATGTTGCAGAACAACTTTACA[
G/T]TTGCTCTCATGGTGCAGCTTAGAGATCCCTTTAGAAACTATGAACCAGTAGGTGCCCCAGTGCTTGCTCTAATCCAAGTGGAGAGAGTATTTTTCC
CTCCAAAACCCAAAATATATAACATGGAGTCAGAACCCAGCAACAGTGGGGAAGTGGTGGATCAGCACGAGTCAGTGGTAAAGGGGGAGGTGGATGGTGA
GATAAAAGAGAAGGAAGAAGACGAAGAACTCATTTCTCAGTTCAAAATCACTCAGGTCCATGTTGCAGGTGTAAATACCGAGCCTGGTAGGAAAAAGCTT
TGGT
chr4_1847860 T Y Y Intergenic
TAGTTGTTATTGCTTTTGATGCCATAACTTAGGTGCATTGTTATGAATTTTTGCTTTAGTTTTCACATGTAACAATGAAATCACATATGCTTTGTGTGTT
ACAGTACCCAATTAAATTTTTAATTTCTATGGTCTCTCTCCTAGCCACTGAAAAAGGGTAAAAAAGAAGAAGAGATCAAAGAATTTCCTGGATATCTATG
TTGACTTACCGATACTGGGCTGATTGAACATCATAGGAAGATCTGCAGCATATTAGCAAACTGCAGCTTAAATATGCCTGCTAACTGCTTGGCAGATTC[
T/C]GTGAGTGTACTTCATTCTTCATCACTAATTTTACTTCATCATGTACTGATAAAATGCATTTAGTCTTTGGCAATAAGGCTCAGGCAAAGGAATGAG
GGAAGCTGCAGTTCACGGAAAAGCTCTAGACTCTGTTTATATTTGGGTTCTACACTCGATACTCTGTTTGCAAACTACATTGCAGGAACCCAGTTAATCC
AGAGTCACATAGAAATGGCAGAGGACAAAAGAGGATAATCGGCCCTCATGGGCTGCATTGTTTGAAGCCATCCTTGTTCTGAAGCCCAAGCTGGGTGTAT
TGAC
chr4_2515800 A W A GSVIVG01035584001 Protein kinase superfamily protein
ATTCCTATACCTTCCAACCCCTCCTATGACCAATTGACCAAGTAATACCTCACCCCACTCCAAAGGAAATTTCATTGAATCTTCTCTAACCTAATACGTT
TCTGGCTAGGGACCACAAATAGATGCATAAAATAGACACTAAGTTAAAGAAGGTACTTTTAATAAGCGCAAGTTTCACCCTTAGATAAGAATTTTCTTTC
CACAAAGCCAATCTTCTCTTAAACCATTATTCATCAAAGTACCAAGCTGCATCTAACTTGAATGGAGCACCAAAGGAAGACCCAAATGACAAAACAATC[
A/T]TTTAAAGAGAAGACTAGGATATCATATCAATAAACCAACATAAACTTTCAAGCGTATGCAAAAGTTTCTTAGCTGTGCAATTCAATAAGAACCAAA
TATTAGCACCCGATCCCTTTTAGAGGCCATGACACTATGGCCAATATTTAGCACAATTCTCCAGGGGCACATCTAGTAGTAAATGAATAATAAGATGGGA
AGAACGTGGAAGAGGAACATATCAATTGTGAACCAACCAAGAGTCCCCTCCCAACACCAGGACAATCACCCAAATAAACACGGATCTACCCCTCACAACC
CTAA
chr4_4124254 A A M GSVIVG01035765001 plant natriuretic peptide A
AAAAAATGAGATTAGATTAAAGTTGAGTTTGGATTAGCCATCAATCTGATTCAATCTGTCCAAGTTGCAACCCGATGCTAATTAACCTCCATAACCGAAA
TTAAACAAAGGTGTTTGCGGGTTTTATGAATGCAGCCACAGCCTGTTCAGGAAACGATCCATCCCCGTTCCCATCAAGCAACTTATTTGCAGCAGCGGGG
GAGGGAGCGTGGGACAATGGAGCAGCTTGTGGGAGGCAATACCGGGTTAGGTGCATAAGCGCTCCAACTCCAGGGACATGCAAAGCTGATCAGAGTATT[
A/C]TAGTGAAGATTGTTGATAGAGCCCAAACCACTGTGTCTAGACCTTCTAGGGATGGTGCCGTCCTCGTCCTTTCTACTACTGCATTTGGGGCTATTG
CTAATCCTTCTGCTGCTTGGGTTAACGTAGAGTTTGCCCAGTAAGTGCCTTCTTAATTAATTTCTTTGGCTTTTTAATATTAAATACATTGAATTATTAA
TTTTATTTAATTATTTCTGTAGGAGTTTTTGATGTTATTTTGTGGTGTTCTTGATGTGCAGGGTTTGAAGGTTGCAATGGATGTTAAGGCCATATACATC
TCAT
chr4_4199905 C M M Intergenic
AAAGCAGCCTAACTTGAAATCAAAAAGCTAGAACAAGCACAGGTGGGTCATGTCATGCTGTTATGTGAAGTACAATATGGGTCACAAGAACCACAAAGTA
GTACAAGTCGGCTGATATTGAAGTACAGGCGGTGCATGTTAGCAGAAACCAACAAGAACACGCTAAAATGGACCAGACGATGTTTGGCAGCTTTGGCTCA
CCAAGAAAATTGAGCTACCACCTAGCAGACTAGTGGAACGAAAGGGAAAGTAGCAACAATATTGAAACAAATAAGTGGGTTATGATGCGCAGCAATAAG[
C/A]GGTGAACATGCTAAGATGCGCGGATAGAGGGTTGACTCACCATGAAACTTGATCAGTTTTAGTTGAGCTTCGAGAAGATGATGGGCTGGACCCAGA
TGGTGGAGGCGAGAGATTTAGGCAGCAACCAGCAGAGAAGGCCATTCTCTCTCTCTCTCTCTCCCCCAAATTTTGAGGAGAGGGTGATTACATATATAGA
GCAGGGGTGTTTGGGCAAATTTTCTCGGAAGTTGGCCAGCTCAAGGTGGGTGGGAAAGACGCCAACGATGGCCCTTAGTGTTCAAACACGTGGGTTGGAC
CCTC
chr4_4833363 A R R GSVIVG01035846001 carboxyesterase 17
CAATATTTTTATCGATTTTTCATTGATAATTCGATATGTATCAATATTTTTATCAATTTTTTGAGAATTTAGCTGGTTAAAATTTCTTTCAAAATATACT
AGTTGTGTAATTAACATGACATCATCCATTCTGCTCCTCCCTAATCCATTCTGCTCAATTACATTAGTAGAAAATGAGTTTCACTTAGAAATTTTGAACA
GAATTACAACTTGGTATTTGCTGCAAAGCCCAAATCTATGCTGAGAGGATACATGCCTCATAGCTAACTAGAAGAGAAGCCGATGACTCGTGGATGGCC[
A/G]TATGAGAGGCTAAAAACTGTGTATGAACTCACTCATTTGCTTTTGCAGCAAGCGAGTGGCCTCATATTTTGGATGGAACATATGATACACATGCTG
CTCTCCTTAAGCTTCCACCAGCTAATTAATTTGAAGTGTCCTTAAATAGGGGTGTAACTTGGACAGACCAATGTTTGGACAAATTTAGGTAAACATTTTT
ATTACTTGAGTTGAGCTTGAGCTAAGTTTTTTCACGCAACCGATACCACATCCTCGGTTGCGTGATGGCCATCTAAGATGCTAGAAGCTGTGGATGAACT
CACT
chr4_5225959 T C Y GSVIVG01035882001 sucrose phosphate synthase 2F
ATTTTACTTTAATTGGCAGGCATTATGTCAATCACATAGCAGTACAGCATATTCATCTTTCATCTCAATGATAAAATGCATGACACGAGGGACAGATATG
TGTGCAGTGCAGAGAAATGTAATGAAATTCATGACCATATCCATACTTCACCCTTGGGTATAGAGGTGCAGCGGAAGGTGGGGATGAACTAAAAGGACTC
CATGGTACATCAGACAAAGGTGCACCAGTATGAGATGGGTTGACACTATCCAAATGTAAATTTCACAATTCACACAACAATGGCAACCAGGATATATAC[
T/C]TGTGCTTATGTGGTATTATTTATTGAAGTACAATCCTGTTCTCAGTATCACAAAGAATACCTTTGTTTTTGCTGCCAGATGGTAAATCTCAGGAAC
TTCAGACTGCTTGTGATGTTTAGGATAAGCCACTTGGCCATACATATCATATTTGTCAATCAGCTTAAGTATTGAAATAAGAACAGATGCATTTGTGCTA
GACATTTCATCGATGTCATCACGGTTGCCCATTATTAATGTCTGCAACAGTAGAAATTGCAAAATCACTGGCATAGAACCCCAAAGAAAAAATGAGCCGT
TTCA
chr4_6021519 C Y C GSVIVG01035926001 SPFH/Band 7/PHB domain-containing membrane-associated protein family
ATTCCGGTTTGTTCATGGACAGTACTAAACAACGGTGGTAGCATCTTGTAAACGCCGGAAATTTCCTTCATTGCGGTGCTGCCGCCACTCCCACCACCAT
CCAAGGCCTCCGCGCCACCACCTCCATTAGTCCAAACGGTAATTTTAGGCTGCAGACCTCGTACAGCCTCAGCATTAATCTTGGCAATCTCTTGAAATGT
TCCGCCACTCACCATCATATAATCCCTCAATGCAGCATAGTTTCCGCCCAGAGCATCAAGGAGTGTGCGTAGATATACGCCTTGGGCTTGCGCCAGCGC[
C/T]ACGATTCCTTCGGCTTCTTTCTTCTTCGCATACAATTCTCCATCTGCGAGTTGCTGGCGTGCGTAGAATGCTGCCTCTGCCGATGCCTTTTGGGCA
GCGGCTTCTTTCTCCTTCTCGTAGAGGACTGCTTCTGCTGCCTTCTGTTTTTTGTAGAGTTCCCAGTTTGCTTCTTGTACCTAAAGTTGTCAGCATTGAT
GAAAACATCAGTAATTAATCACATTTAAATTGGTATTTTAATTTTATCGATAATACATCGATAGTCTAGATCAAAACTTATGAAAATATTAAGAAAAACT
TTAA
chr4_7631202 C M C GSVIVG01036033001 Protein kinase superfamily protein
CATGGAGTAGAATTGAAACAACATGAAAAACATTAGGTGCACTACTTGTTTGTGCTAGAGAAACACTAGGAATACCCAACAGAGAATTGGATTTTAACAG
TTTCAGAAGGTGATTCATCTACTCCTTGCTGAAGGGACTTGACTCTGATTCATTGACAGCAGCATTGACCTTGGGATTTGAACGATTGCTTCTCTCTCCG
GGCTTGCTGCTCTGCCAATTTGCTGGTGTTCCATGGATTTTCCAGCAAGTTTCTCAAGTGTGGCGCAGTTTGTTACAATAATCGCATCAGACCCGTGGC[
C/A]TTTCTCCAAGCCCTTGCTGAAAACTGGCTGCTTTATTGGCAAAACCTTCAACAACATTGAGAGCAGAACTTTCAACAGTTCCACTATTAGATTTCT
TTCCCAACATTACGTGTCAACGACTTTTTGCCCTTTGAACTTCAGCAAAGACTTCGCTGATTTTAGGAAGAGGAACTCTGCCAATAATCCATCCTCTAAC
CTCATCAAACTCTACACTGAGTCCAACACGAAACTTATAAATCCTATGAGCCTCCATAGTTTGTTTGTAATGATTAGCATCATTAGTGGACTTTCATTCG
TAGT
chr4_8005927 A R A Intergenic
TGTGGGCTCCATGGTGGCTGTGTGAGTTGTGCGGGCTATGTGGTGGTTGTGTGAGCTATGTGGGCCGCATGGTGGCACAAATGGGAAGTGGTTGGTGAAG
ATTGGCAGCTTTGGGACTAAAGTCGGATGGTGTTTCAGTGGTGGAATGAGTGAAAGAAGTAGTGAGAGAGGTGGGTTTGGTAGGTATAGAAAATGAGGAT
ATGAATGGTGATGGGTATGGGAGGCATGAAGAGTGGCCATGAGTGCATAAATCCTATGGGCATGGGTAGGAAATGGGTAGTAGGGCAGCAGGTTGGGCA[
A/G]GTGTGAAGGAAGTAGGAGGTGAAAGTGTGGTGATGTGTTTGGTGGATGGGTTGAAGGTAATAGGTATGGAAATGAAGGTGGCCACACGCGTTAGAC
TCCATGTATGTAAGAAATAATGGAAATAAACTGAAGGTGGATTAGATGGTGTGGTTGGGGAGCATGTGGGTTGTGTGTGGTGGCTATGGGGTGGCTGTGG
GCTGCATGTGCTGGATATGATGGTCATGGGGTGGCTATGGGTTGCATGTAGTGGTCATAATCAGGATGATGGGGGATGATGGTGATGTAAATGGGGGAGT
AGTT
chr4_8891149 G R G GSVIVG01033170001 cyclic nucleotide-gated channel 14
AATCTAGCAGTGTTCAACTAGTAATCATCTGGCTCAATCGAGAAGTCTGGCTCTTCAGGCTTCTGCAGCTTGGGCATTTCAACATCCTTGACCTTTTGAG
CTCCTCGCCTTGTGTTTTTGGCAAACCTTGAAGCCAGTATGGTGACCCCTAGATGCTGCTTTGCCTGAGAAGAATTTGATTTTGTGGAGCTCCCTTCATC
CTCTTGTTCGGTTTCATCTTCATCATCTGCATGGTCATCGTCATCAGCAAAGGAGAATGACTCTCGCATGCTGAGGTTCTTTGCCATTATCCGCTTCTT[
G/A]TACCGGCGCCAAGCAGCCTGAATGAAGCAGGCTGCCCAGGTCCTCCAGTGGTGAGAGTAGAAGCGGAAAGTGTGCTGCAGCTTCTTACTATGGAGA
CGTCTAAACTGATTTGCAACAAACTTGAGATCCTCTGCTCGCAGTGCAAAGGCTTCCACCTCAACAAGGGCTCTTACTGTTCTTGTTGAAGAGGGCAAGT
TCTGAGTAATTTTGGGAAGTAATGCCCATGCAAGCAACTCCTCCCCGCAAAAATCGCCTGGCCGTAAAGTAATTGAATTGAAGAAACCTGTTCTGCCTCC
ATTC
chr4_10404144 C Y C GSVIVG01035204001 auxin response factor 8
TTGATCTGCCAACTTCACAATGTCACAATGCATGTGGGTCTTTACCGAATTTAATAATGTTGCAATTACAATTGTGGATGTATTTTAGTGAGAAGGTTTG
TAAAATCTGCAAGGGAATTGATTATGTTGTGAATTATGTGTGTGGCATTTCAGGCAGATGTGGAAACTGATGAAGTGTATGCACAAATGACTTTGCAGCC
ACTTACACCGGTAATCTTGAGTTTCTAGTTCCAAATTGAGTTTCAGTTGTGATGTTTAATTATTTCCTTGAGTTATATTGAGTTGGAAAATTGTTTGTT[
C/T]TCTGGTGTATACAGCAAGAGCAAAAGGATACATTTCTTCCTGTGGAGTTGGGTATCCCGAGCAAGCAGCCCACCAATTACTTTTGCAAGACTCTCA
CAGCAAGTGATACTAGTACCCACGGGGGGTTCTCTGTTCCTCGTCGCGCAGCTGAGAAAGTTTTCCCTCCATTGGTAGTCTCCTTTCTTATTTTCTTTGG
TTTGATGCTATTCTAATACTGATTTACATTTTAATATTTGGGTTCACAGGATTTCTCTCAGCAGCCTCCAGCTCAGGAACTTATTGCAAGGGATCTCCAT
GATG
chr4_10552054 G S G GSVIVG01035211001 Leucine-rich repeat receptor-like protein kinase family protein
CCACTAACTTGGTGAGGTTAGTCAGCGAAAGAGGCAGCTCACCAGAAAGAAAGTTGTGAGAAAGATCAAGGTGGGTGAGTTTTGTGAGAGTACCTATTTG
ATGTGGGATGTCACCATTCAGGCCAAGAGAGCTAAAATTTAGTCGAACCAGATTTGGAAATGAAGAGAAGTTAAATTGGGTAAGCAGCCCATTTTCTTGA
GTTGGAACCGCCCAAATCTCAGTGACACTTCCCCCCGCATTACAGCTTATGCCTGGCCAATTACAATGGCCTGTAGTAGTGTTGTAAGACCGCCACCAA[
G/C]TGCTCCTGCGCAGAGCCTCACCCTCAATCCATGTCTGTGATGATGCTGCTGCTGCCGCGGCCATTGCAACCACCCACATTACTATCACTGCAGAAA
TGGAGGAGGCCATGTTTAATCATGCAATTGTCTGTGCTCGAGACTGGGAATAAGGACTTAAAATATGGGCGAGGAGAGTCTTGAATCAAGCACACTGCCC
CTCAAGTCATTAGTCTTCGGGTATATTTCTCCGTCAATATTGCTGCAAGATTTTTGCCAAACTTCATCTTGTTTTCTTCGTCAAACATAGTAGGATTTGT
TTAT
chr4_11092849 T Y T GSVIVG01035239001 ARM repeat superfamily protein
ATGAATACAAACCATATTCTCTGGTATTGTTGTATCTTGGTTAAGAGGAAGTCAACTAAATGGATAATGAGGCTTCCTGGTTGAGGCCAGAGCAAAGCAG
CTTGAGAGGAAGGTCTTTAGGTGGAGTGATGCAGTGTATCCCAAGCATGGATTTCTCTCAGTAGGATTTCCAAACTGAGAGAATCAATAGTCTGGATTTG
AGGTTAATTCCGCTCCAAATGAGTTACCTTTAGCCTTACATAAGGATCTGAAAAGAATGCAAGCAGCTTGGATATAATTTTAATCCCTGGATGCTTGGT[
T/C]TGTTTAGGGTCCACTAGCTCAGAAGTGTAGAACTGTACAACTAGCTTACAGCTATATTGGCAGGTTTTGTTGCTGATGCAGTGCTGCCATGTTGAG
GGTGGCACTCATCCTAGAGCCTTTGACAAATCCTTATGTCTTAAGTTGGCTGAAAGTCTTCTAATATGTTTTGTATACACCTGGTTACACACACCTTGTC
TATCCAGAGCCAATACCCCAGGCTATCCCTTCGGTTTAACATTCAGGGATGATTGCATCATGAACTAGTGCAGAGTTTGTATTAATACCCCAACCTTCCC
TTCA
chr4_12174593 T Y T GSVIVG01001480001 Haem oxygenase-like, multi-helical
AGAAGTGGATTGACAACTATTCTTCTGAAGGTTTCCAGGTTTGTACTTAGCAGTGAGCATTTTTATTTTATTTTAAAATTGTCTAACTGTAAATCTCTGC
TGACGCCATTCTGAGAGAAGTATACTTTACATAAATGGTTTTCTCACTCAGGCAGCTTAACTAACTTGTTCTTTGAATTTAGGGTTCAGCTTTACAAACT
GAGGACTTGCTGGATAAACTAAGTGTCTCTTTGACAGGCGAAGAGCTTGACATCATAGAAAAGCTTTATTACCAAGCTATGAAACTTGAAATAGAGTTC[
T/C]TCTGTGCTCAGCTGCTTGATCAGTACACTATAGTTCCTCTAACTAAAGGGCATGACCCTGCAGCAGATCGTCTTGTGATATTTTCTGATTTTGATT
TGACATGTACAGTTGTTGACTCTTCTGCCATTTTGGCAGAGATTGCAATAATAACAGCACCAAAATTTGATCAGAATCAACCTGAAAATCAAATTATTCG
GATGTCCTCAGCTGACTTGAGGAACACATGGGGTGTTCTATCCAAGCAGTATACTGAAGAGTATGAGCAATGTATAGAAAACATTCTGCCATCTGAGAAA
GGTA
chr4_12232042 A M A Intergenic
AGTCCACACACACCCCATGGCCACCATATGCAACCCACACCTCCCTCACAGCACATACACAACCCATAGGTAGTCCACACACACCCTATGGCCACTATAG
CCACCACATGCAACCCGCACCTTCCTCACAACACACACACACACAACCCATAGGTAGTCCATAGGCACTCCATGGCCACCATGGCTACCACATGCAGCTC
GCATCTTCCTCACATCACACATACAACCCATAGGTAGTCCATAGGCACCCCATGGCCACCACATGTAGCCCGCACCTTCCTCATAGCACATACACAGCC[
A/C]ATAGGTAGTCTACATGCACCCTATGGCCACCATGGCCACCACATGCAGCTCGCACCTTCCTTATAGCTCACCCATGCATACCTCACCTTCACACGC
TCACCCACATGCAGCCCACACACCTCATAACTCACCCATGGTCTCCACGGCTCATCCAAAGCCACCCCATGCATCCCCATCTCACCACAGCTCACCCATG
GCCTCCTCACCACCACCATGCACCCACAACCACCCTTAAGGCCACCATATAATTGATCTTTGGTAGTTGAATTTTTTATGAAGAGTTATGAAATTTGTGG
CTGT
chr4_13019589 A W A Intergenic
GCTAAAGAGCTAGAGTCTATTTAATTGACAAAACAAAATTTCTAAATTGGTGGATTCATCCTCCCCCAAAGGCATAAAGAGGAAAGTCTTATCCAGAAAC
CATGGAATCCGCCCCTCTTAACTAACTTTCAGAAATGGGAAAATCATCGAAAAGCAGCCAGAGAAAAGCTTATCAACTATTTGCGAGAAAAGTCATGGAG
GTTTCCTCCGAGAGAACCTCAAACTGCTGACTATTTGATTTGTTGGACTTTGACTATGACGATTCAGGCGAACAATGGGGAAAAGAGCACATGGTTATG[
A/T]CAGTGAATAGAGATGCATGTGAGTGGGCGGTGGGCGCTGCATGTGATCACGTTGGCCTATATTCATGAAATGTTGCTTTCATCCAGTGCTACGCCT
GCCAGCACTGCCACATGCTGCTAATTCCTTCTGGTTTTTCTTGAGCTGGATTTTATAATTCCATCGCTCCATGTTAAAACTAAAATATTTTAAATCACAA
TACGTTTCCACCATTTGAATGCCTTCCGTAGTACAAATGTGTTGGACAGTATAGTTGGAGTAATGTGTATGAAAGAGAAATACACAATACCACTTTCCCT
TTAA
chr4_15481952 G G K GSVIVG01026388001 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
CATAACAATATCCTTCTACAATGAGAAAGAGACATGCATTATTAGACCCAACAGAGTACGTAATTATATTACTAGTCTTCCTCCAGCGCCAAACCAGGCT
CCTGCAGTACGAGTTGAGCCTTTTCCTGAATGAGCTTCCATAGACTATCAACATGCCTAATCTCAGTCAATGTGGACCCAATTGCACAGCGTATGATATA
AATCCCACCCACCACTGCATGAGTCATGAATGCAGCACCACTTCCATTGACAGCCATTAGCAGCCTTGAGTTCAGTTCTGTGCCCTCCCCTTCTTCTCT[
G/T]GGCCTCAGTCTGAAGCACACCAGTGCAAACCTTCTCGGCACCACAACCTCAAATCTGGGATCTGTGGCTACATGTGCCTCGAATCGCTTGGCCAAG
TTTACATCGCTGCGTATATGGAACATGAGGTTGTCCAAGCCATGCCTTCGAATCACCACCCAAACTTTGATGGCCCTGAATCTTCTACTTAGTGCTATTT
GCCAATCTTTGTAGTCTATGACCTTCTTTGATTCGCTTGCATTGTTCCTCAGAAACTCAGGAGCAGTTGATAATGAATCCACAAATAGCTTTGGTTCTTT
AATC
chr4_15703114 A G R GSVIVG01026406001 Protein kinase superfamily protein
TATCAGTTGTCTGAATAATTTCAGGTATGGTTTCAATTTCTGAGAAATTCATACAAGATTTTTACCTAGCCAGAATCATAGTTGGTAATTTTTTTCCCTC
TTGATGACCAGCCTGAAATTTGAGTCTACTCTTGATTTTGCAGCTATGGAAGGAGGAATATACGTGGAAGATTACCTATCCAGAATGATCCAGGTTGCTC
CTAGTTCTCCGGCTTTTGTAGCAACCGCCCCCATCTCTGCATCAGCTAGAACTTCAGCTGCAGTTTGGACCTGTCATCCGATGATTGATCATATAACCC[
A/G]ACAACAATTGTTACAAAACAACACTGTGAGAAGGAAACACCCCCTGTACCTGCTTGACATTGTGGGCTAAACACAGTTGCTGCATCATCTGAACAC
AGACACCGTTGATTCGATTGGATGCATCATCCTGAGCTCTATTAACAAGGCCCGCCTGATCAGATGTTGAACTCTCCTCCTGCCTAAGACCCAGTTTCTT
TAGCAGACCTGAAGCAACAAAAAGAATCAAAACATGGAAGACATGGCTAACAAAACTGTCCAAACCAAGCAGAAAGGAGAAATGGAAACCTACAAGAAAG
AAAC
chr4_17487857 T C Y GSVIVG01019038001 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein
TTACAGAAATTCAGATATCGACCTCCCCATAAGGAGATTGCCAGAAAAAAACTCTAACTGGAATTTTGGTATCCTGAGACATTATTAGACAATTCCCAGG
CCACTGAAGTGGTCAAGGTTCTTGACAGGGCTTGCACTATCTCAACCATATCTGGGCGACTTGCTGGAGATTTCTTTAAGCAGCTATCTATCAATCTGAT
CATAACAATGGCAAGTTCCAAAGGATAATTCCCACTCAGGGAAGGATCAATGAAGTTCCTCAACTTCTCCTTTCCATCTCCCTCATGGAGCACAGCAAC[
T/C]AAGACATCTGGTAGGTGCATGTTCTCACCTTCATATAATGCAGCAACTTCTTTCCCTGTAAGCATCTCCAGCATGAGAACCCCAAATGCATAAACA
TCAAGCTTTGTGGAGACCAAACCATTCTCCAGATACTCTGGTGCCATGTAACCTCTTGTCCCAATGATATGCCTGGTTAAGGCAAACTGACCCTCCTGCC
CCTCTGCTGACCTTGCTAAACCGAAGTTAGCAATCTTAGCCCTGAAGTCACTATCAAGAAGCACATTACCGCTTTTTATGTCCTTGTGGACATAGGGAGG
GCTG
chr4_18007386 T Y Y GSVIVG01018993001 U2 snRNP auxilliary factor, large subunit, splicing factor
CTTGCTGCAACACTTGGTCCAAGTCAGCCCAATCCCAATTTAAACCTTGCTGCTGTGGGCCTAACACCAGGTTCTGCTGGGGGTCTTGAGGGTCCTGACC
GCATTTTTGTTGGTGGGCTCCCCTACTACTTCACAGAAGCACAGATCAGGGAGTTGCTAGAGTCTTTTGGTCCTCTTCGGGGTTTTGATCTTGTGAAAGA
CAGGGAAACTGGAAACTCCAAGGGCTATGCATTTTGTGTTTACCAAGATCTTTCTGTTACTGACATAGCTTGTGCTGCATTGAATGGAATTAAAATGGG[
T/C]GATAAGACTCTCACTGTTAGGCGTGCAAACCAGGGTGCTTCCCAACCTAAACCCGAGCAAGAGAATGTATTGTTGCATGCACAGCAGCAGATTGCT
TTACAGGTGGAAAGAAACTTCATGTTATCATCTCTATTTATTGGGAGATGTTGCAAATTTGCTGTCAATCTTAAAATTAAAATATTATGCAGTAATATTA
ATTTTGCATTTTATTTCAATGGTATTCTTGTTGCATATTATGATCAATAACAGCAAGTTGTGATGCTGCAATATTTTTTCTAAATGGGCTGTACCTATCA
AACT
chr4_18532146 C C Y GSVIVG01018938001 Galactose mutarotase-like superfamily protein
GGTAGTGGAAGTTCTCTTGTTCAAGCTGGAGTTGTAAACTCTCTTAGATGGAGTTATGATAACTAAAAAAATTTTGAGTTTTGCTTCTTCCGGTGCTCGT
GGATCCAATTTTGCTCTCTTTGGTTGTGTACTTTGATATTTTGGTTATCTTAAAACATATACTGATTATATCTCTGTTGACAGTGGAGGAATTCCACATT
GTTTCCCACAGTTTGGACCTGGCCCAATGCAGCAGGTAGGGTCCTCCATCACTGTTCCTTTCGCTAGTAATAGCCTTCATTCATCCACTTGTTTCCAGC[
C/T]GTTAGGAGTTAATTGTGTAGCTCATGAGCTGTCAACTACATCATTTTGAGTGGCTGCATAATAATGTCACCCACCAGCTATGCCTTATGGTGATGC
TGCAATCAACGCTTCACCCTAAGTGAGTGCCTTTAGTATATATCCTGGAGGGTCATAATGGAATGTCATGGATCTTCTACATGGATGGTTTGGCCAAAAG
CATAATGGTTAATGTGGTATGCTTGTATTGAATCTAGTGACTAGTAAGCTTGTTCCCACCATTGAGAAATCCTATCTTTTGCAAGTTGTGACAGCATGGT
ATAC
chr4_20559077 C Y Y GSVIVG01003838001 serine acetyltransferase 3;2
ATGGAACCATGGGCGTAAAGAGTTGGCATTAGCATTACAAAGTCGGATCAGTGAGGTAGTCTCTTATTTGAAAATCTTTGAATCTGGAGCAGCATTATGA
CCATATTATATGGATTTGTGCCTTTCCTATTTCTCCTTTTAATCTGGTAACCTTTATTTATTTATTTTTGTCTAGGTTTTTGGAGTTGACATCCATCCAG
GTATGTATTTGCTCAAATTTGTTTTATTGGATAGATATCCCATTTACAATTTGTAGCATATTTTTCATTAAGTTTATTGTAGGAGCGAGCAGCAACATT[
C/T]CTTGTAAAAGGGATGTAACTTTTGAGAAACCTATGGTGAAATCAACTTAAATGTGTTTACAGCTTACCTGGTACTTAGATATGATTCTTGTTTCAA
TGAACAGTTGCTGCCATTGCAAGTCTGGAACGATCTTTTTTAACTTGTTGGTTTGTAGCTATGCGAGATGACAAAGGTTTCCTGGATGATATCCACTATG
AGATGAAATTTTTCCTTTTTAATTAAATTTGGTGATTCTGTACAGCTGCACAAATTGGAGAGGAAATACTTCTGGATCATGCAACAGGCGTGGTTATAGG
TGAA
chr4_20559130 G G R GSVIVG01003838001 serine acetyltransferase 3;2
AGGTAGTCTCTTATTTGAAAATCTTTGAATCTGGAGCAGCATTATGACCATATTATATGGATTTGTGCCTTTCCTATTTCTCCTTTTAATCTGGTAACCT
TTATTTATTTATTTTTGTCTAGGTTTTTGGAGTTGACATCCATCCAGGTATGTATTTGCTCAAATTTGTTTTATTGGATAGATATCCCATTTACAATTTG
TAGCATATTTTTCATTAAGTTTATTGTAGGAGCGAGCAGCAACATTCCTTGTAAAAGGGATGTAACTTTTGAGAAACCTATGGTGAAATCAACTTAAAT[
G/A]TGTTTACAGCTTACCTGGTACTTAGATATGATTCTTGTTTCAATGAACAGTTGCTGCCATTGCAAGTCTGGAACGATCTTTTTTAACTTGTTGGTT
TGTAGCTATGCGAGATGACAAAGGTTTCCTGGATGATATCCACTATGAGATGAAATTTTTCCTTTTTAATTAAATTTGGTGATTCTGTACAGCTGCACAA
ATTGGAGAGGAAATACTTCTGGATCATGCAACAGGCGTGGTTATAGGTGAAACTGCTGTTGTAGGAAATAGAGTTTCATTAATGCAGGTAATTTGGCTTC
TATC
chr4_21141468 G G S GSVIVG01026605001 nodulin MtN21 /EamA-like transporter family protein
AGACATGGCCGCCTCCCACCATCGTTGAAATTAGTGAACTCACCATGACCAAAGCAACATGCCCATGACTTTTCTCCACTTGCGTGTATGAGGTTCCCGT
AATCGAATTGGTAATCCAAGACCATACATGGTGGTTGTAGACATGATTTGGGCTTGGACTTAGAGGAAACTTTTCGCCAGCCAAGCTGCCTTTTTAAGAG
TTTGTCCTTTTAAGAGTTTTGCCTACGATAGACCGCAATACGCCTGCAAGGACGTCAGCAAAAGGACCCCCACACATCACTTTGGAAAGCATGATCTAA[
G/C]TGTGGATTCTGGATTGCTCTATCTGACATGATTCCAACAGCCGGCAGCTCCACTATTATGAGGGCGCCTCTCTCAGAAATCCCTTTTTGTCTATAA
ATACTCATATGGTTTGAACCAGAGAGTATCCAAACAGCCTCCCCAACAGCTTCATTTGCTTCATATATAGTCATTGGCTTGAGCTATAAACAGCTTTTCA
GTTGGTATATTACATGGCTAGTGGGAAGTTTTGGAATGTCATGACAGGGCTGAAGCCAGTCCTGGCAATGGTGGTGGTTCAAGTGTCACTGGGAGGAATT
AATA
chr4_21757454 C C S Intergenic
TCGGGAGGCTTCAGGAACCATTTCGCAGGAGAAAAATGGTGTCTACGAAATTTCGCAGACACCCAAGAGGGCTGCGAAATTATTTCGCAACACCGAGCTA
TCTTCACAGGGCTGCGAAGTTGGCTTCCACCTTGAGGTTCCCAGCTCCCTTCTCGCGGCATGGTTCGTGTATCGTCAGAAGGAGAAACACCTTACTGTAC
AAAAGTGCTGCGAAATCACTTCGCAACAAAAGGGTGATTTCGCAACACTTTGCAAAATGCTTCCTTCAGCTCGGAGTGACTGGCTTGTAATGGCTGCAA[
C/G]TTCTTCGTTTCAACTCCGAATTGCACACCGTTTGAAGCATTGGATTGTTGACTTCCTGAGCTTTGAAATGGTATATATCATGCATCATTTGAACTT
CAGAAAGTGCTCCAAAAGTGGCTGCTACGACTGTCATCAAGAATAAGCTTCATGGCAGATTCTCTTTGCTTTTTCTCCTTGCAATCCAGATTCACTCTTG
GCAAATGAATTCTAAGCTTTGCCCAAGATTCCTCAAAGCTCTCCTCATTCTTGACTTGCTTTGGTGATCAATATACTATCAAAAACACCAAAACTTACAC
AAAG
chr4_23096569 T T W GSVIVG01026467001 histone deacetylase 14
TTTAAATCATTAAGCAGGATATTATATCAGCAACTAAATTGCAGGAAGATTTAAACTAAATAATTCATCAAGAGAAATCAAATACCACAAATTGACCAGA
ACCAAAAACTGTAGCTTACTTGATGAGTTGAAAGGAAGAATATATCTGGGTCATCATAGAATGCATCATTTGTTCCATTCCCATGATGAACGTCAAAATC
AATGATAAACACACGCTTTAATCCATGTACACGTTGGGCATAACGAGCTGCAATGGCCACATTTCCAAAAACACAAAAGCCCATAGGACCTTTTGGAAT[
T/A]GCATGATGACCTGGAGGTCTTATCAAAGCAAAACCCATTGGTGGGTCCTGGCTGCTCTTTGATGCTGCTACCTGAGATATGACAAGATTTTGGCAG
ATAGTTTACAGACAAGAACACCAGCATCGAATAATAAAACAATGAAAATAAATTGATTGAATTTCTAAGGAACACAAATGTACAGGATGCCATATTTAGG
AAAGACCAAAATTAAAATAATTTTAACAGGTGAAGAAAAAGAATAATCATTAAGTCACTAACGTGCTAGGTTGAGGCATCACCACTGAATCAACTAAGGT
GATT
chr4_23534544 A R R GSVIVG01026448001 RNA polymerase I specific transcription initiation factor RRN3 protein
TGTCTAGTTAGGTCAAAGATTTTCGTCTTTTCTTTTTGCCTAGCTCTTGGGTGTTGTTTGTATACTTCGTGTGTACTTTTTTCGCCACTTCTAGGCATTA
CTAGTACAAACTTTTATTTACCTATCAAAAAAAATAAAATAAAATAAAATAAGAGCCTCTTTAGGGGATTTGCCATGCAAATGATCTTCCTTGCACTGTT
AGAATAATTTATAATTTACATGTAGCAGCCAAGGCTTTTATTTTTTGTAAACTGATGTGGAGATCACTAGCCACACTTTGCAGGACTGGGAAAAACCAC[
A/G]GTTACATGACCCCTCCCCCTAGAGCTGCATAATGGGTAAGCCAGGCCTCAAACTTGAGACCTCTAATCTGGGAATGAGATCATCTATGAGTTGAGC
TGTCCATGGGGGCAATTTATGTAACTATGGCTTTGTTGGTTTGAAATTAACAATTAAAACAAATAATCTAAGCCAAGGGTCCATATAATTGTATTCTTAG
TTTCATGCCCTCTCCCTCTCAACTTGAATCACCTTTTTCGTGTTCCTTCTTTTGTTATAACTGGTATTTTGGATGCCTTTGAACTATGGATCATGACGTT
TTTG