Home >

Resource Information


교배실생 GBS

TanoRed X Ruby(seedless) 교배실생 150개체 GBS data를 이용하여 만든 Genetic map


Genetic Map viewer


Chr No


MarKer ID Ref. Tano
Red
Ruby
seedless
Genic
Intergenic
Descript Flanking Seq.
chr4_1293512 T W W GSVIVG01035442001 alfin-like 5
CTATAACTCCCCAAGGCACAATGATTTCTGGGTTGAATGCTATTGTAAGTAGCAGTGATGAACTATTCATTCAAGAAAAAAGGAAATAAAGAATATTACT
GCCAATCTATTAACAAGGCGATGCTGGGCACCATAACATATCAAGAATCCATGGTTTATTAGTGGTCAAAGTTGTTTGCCACAAAGTGGCCTCTTTATAA
TTTTCGTAAGATATGTACCAGCATAGCAGCACTAACCTAAATGATGCCAAGAGAATACCAATATCACTCAACCAGGGCTTTTGATTTTTACAATGGGGT[
T/A]AGGGAAATAGAAGTCCTTCCCTACCTTAGAGTTTGATTTTGATTTGTTGCTGCTGTGATTTGAGACTGATGACTTTTCCTTAACTTGTTTCTTGGC
TGTTCCCGTTACAACCTCAAATATTGTTGGAAGATCATTTATCATGTTAAAAAGGCGTTTCCTGCAACAAGAATACCCGCAAGAAATCACAGTCAGTAAA
TGAAACCATATAATACAACATCAATAGACAACAAAAATACATAGCAAATTGCAAGCACACCATGTTTTAGCCAGAGTTAGCAAACTTCAGAGCCAAACAA
TGGA
chr4_2013337 C G S GSVIVG01035525001 H(+)-ATPase 5
ATGTATCGAATGGCAAATTTCAGAAAGTCAAGTGGAACATAGGTAACAACGCTGTACAGCCAGATGACTCCAGCCCAACCCCAGCCGGTTCCCTTAATCC
TTGCGAAACCCCAGTTGGCATACACGGATATCACAGTTGCAACCTGTCAATTACAAGATGGTTAACCATGTTTAATAAAGCAAGTTAAATATCTATTTTC
TGAATCAGATACTATGGAAGCTCCAAAAACAAGCATCATGATGACAACTACAGCACATTAGGTACGTTCTTACCAGCTGAGCTGCAATGAAAGCACCGA[
C/G]TAAGAGAAGCCCAGGGCGTTCAACATAGGACCAGCTTCGAGACCTTGTCACGAAAATGAGGGCCTGACTCACAATACTCACTTGTAGGTATAAGGC
TGCCATCATTTCATGTTCGCTATATCTTATTGATTTTACACCAAACTTTTCCTGAATAGGAATAAACAATATGAATGAACAAAAATATTTGAAGCTACTG
TCTCTAAAATTATAAGTTTAAAAATAAATAAAACATTTCTTACCGGAAAGAAGTCGGTATCTTTCATGACCCAGAAGAATACAACAGTCATTAGGGCCAA
GTAA
chr4_2016632 G R R GSVIVG01035525001 H(+)-ATPase 5
TATTTCACCCTGTTTACAAGTTGAACCAGAAAATACTTCATCCGAAGGATTCTTGGTGACAGGGAGGGATTCTCCAGTAAGAGCAGATTGATCAATCTTA
AGGGGATCACCCTCAAGAAGACGGGCATCAGCGGGGACAATATCACCCAATTTAATGCTAATTATGTCTCCTGGAACAAGAATAGCTGCATCCTGCTCAG
TCCATCGTCCATCCCTAAGAACCTACATTATGTCACCATAAGAAATTAACAAAACCTAAGAAATAGGAACAGGACAAAGTTATAACTTTGAGCATGGTG[
G/A]TATTTTTACCTTCGTCTTGGGAGCAAGGCCAGCCATTAGGGCTGCTGCTGCATTACCAGCATTGTTTTCTTCAATAAAACTGATTGTGGAGTTGAT
CAACAGTAAAACAATGATACCAACAAAGTCTTGCCAATCTGGAGGCTGGCCACCACCATTTGCTAAGGCAATAGCCATAATAGCTGCGGCTTCCATAACC
CATGACAGAGGATTCCACATAAACCCCAAAAACTTGAGGACTTTGCTCTCCTGTTGGCGAAACATTAAGCCATCATCTTCATCACCATAGGGATTAAACT
AACA
chr4_2515800 A W A GSVIVG01035584001 Protein kinase superfamily protein
ATTCCTATACCTTCCAACCCCTCCTATGACCAATTGACCAAGTAATACCTCACCCCACTCCAAAGGAAATTTCATTGAATCTTCTCTAACCTAATACGTT
TCTGGCTAGGGACCACAAATAGATGCATAAAATAGACACTAAGTTAAAGAAGGTACTTTTAATAAGCGCAAGTTTCACCCTTAGATAAGAATTTTCTTTC
CACAAAGCCAATCTTCTCTTAAACCATTATTCATCAAAGTACCAAGCTGCATCTAACTTGAATGGAGCACCAAAGGAAGACCCAAATGACAAAACAATC[
A/T]TTTAAAGAGAAGACTAGGATATCATATCAATAAACCAACATAAACTTTCAAGCGTATGCAAAAGTTTCTTAGCTGTGCAATTCAATAAGAACCAAA
TATTAGCACCCGATCCCTTTTAGAGGCCATGACACTATGGCCAATATTTAGCACAATTCTCCAGGGGCACATCTAGTAGTAAATGAATAATAAGATGGGA
AGAACGTGGAAGAGGAACATATCAATTGTGAACCAACCAAGAGTCCCCTCCCAACACCAGGACAATCACCCAAATAAACACGGATCTACCCCTCACAACC
CTAA
chr4_3007371 G G K GSVIVG01035651001 embryonic flower 1 (EMF1)
TTTAATGTATTTAGTCATGGAGTGTTGCATGAAAATGGAACATATATAAACCATTGATAGGGTGCTGGTAGCAGTCAAAGAGGCCACTGCTCCAGGGGTT
GCCAACAGCCTGAATAAGAATCAGATGTATCTGTCCAGACTCCTGCCTTGTCACGGGCACGAGAGCATTAGCACCGCCACCTCCAGCGCTACCCTCCATC
TTGTTAGCCTCTGGCAGCGGGGCGGCATACATCACAAGCTGGTCGTTTGGACGCGGCGGCTCAACCACTTGCATTCTAGGCTGGGGCGGGAACGCTACT[
G/T]CTGGGATTGAGTCTATCCCATTCTCCAACTGTGGCTGCTGCTTCCTCACGTTTGCAGTTTCTGGTGCCAACTGCACTGGCTGGTTGCTTGAGGGTG
GCGCGTGGCTGTCACTGGTCTGCGGTGGGAAGGTCACAGCAGGGGTTTTGTCTGTGTTCACCGTCAGGTGGAGGTGTCACGTGAGGCACGTGATGATCAT
TCGTGTGAGGCTCGGCCGTGGGGTGTTGTGGGGGTTCCTGCTCCATGTGTTGTGGTTGTTGATGATCATCATGAGCCGGGGAGGAGGTGGTAGTGTGGAA
ATGA
chr4_4181406 G R G GSVIVG01035772001
TTGAGCTAGGTGCCAAACCTGCACTAGCTTTTTCACCTGGTCCAACCAGTCAACCATCAAGGAGCCCAAAGAGTAGGCATGACTTGCCACTTCCATCACT
GGGGGCTTGCATGACACTAGATTGCATGGATTGTTTGATAATGTCCCCGCCTCATAGTGACCGACCTTTACTGAGGGCTTGGTGGTTGTTGAGTGAGCTT
AGGTGGCCATGCTCACTCAAGCAGCTAGGGCTTTTATTCTCATGGTGTAGTCTTTCGGTCATCCTCCACACCTCCTCCACCTGCTTCTGGTACTCCATC[
G/A]ATTTAGTTTCCATGTCTCTTGCATTGTCGTGAGGTGCTCCTCCAAAGTAGGAGTGGGAATGTATTCATCTTCTATGGTGCTTGCAGCTAGGTGGTC
ACCATGTAACTTTCACGGCTTGTTGTCTGTTTCCCACATTCGGTGTGAACTGTTGGTGCATGGACTTCCAATGTGGGTTGGTAGATGGGTGAGTCCAACA
ACACCCTTGCCCTGCTGCCTGGTGATCGAATGAGTCGGCTTGTACTACTAGGACAAGCTTTTACAAACAAGGATAGTTGAGGGGTTTCCAACTATGCCCC
TTCG
chr4_4903979 G R R GSVIVG01035855001
TGTAACAGAGCAGAGGTTGTCTTGGATGCTGTAGTAAGCCCACAGAGATTATTGGTGTGTATGAGTCACCAAAGGGACTGACAATTCAAGGAAGAACAGC
AATGAGACCTAGCCCAGTAGAGGATTTCTGGAGCACTAGCACAGGTGAGATGGATAATAGTGCAGTTCAGTCCCAAGGAAGCATTTCATCTATCAGCACA
TCAAACCAAACCTTTGATCCCCACAGTAATGCGGGCAGCACAAGCAACCCTCCTGAATTTGTAAATCATGGCAAGTCCTTATCTGTTAACTTTTGCATC[
G/A]ATATATTACCAAGCCTCATGTTTGATTTCTATACTTACAACCATTGGACCATTATGGATGTGTCCCAAATTATGTGTTTTGCACACCATTTCAGCT
TTTCCTATTTAGGATGCTGCTGAGGGCTCCTATCAATATTATCTACATTTGTAGTTTGTGGGAGGACTCCTAGAGTACTGTAGCTAGGGCCATTTGATGG
TCATTTGATTGCAGCTGTTTCAAGATTCAGATTCCTACCAATCTTTTTGGATAAACCAGATGGTTCAGCTGTTCCCACTTCCATTTTGGTTGGTATACAG
AATT
chr4_6540279 T K T GSVIVG01035963001 nuclear RNA polymerase D2A
TCAATGAGTTGTTGTTTCTGATAAAAGAAAGCCATATTGTCAACTAGGAACTCAGCTTTAAAAACTATGATATGGAATCGTGTGGTTATCTTGGTGGTAG
TTGGTCTCTGGTGCACATAGAACTTCTACATAGAAATTTATAATAACATATGCAATGTTATGCTTTATGACTAAAGCTTATGTATTCAAATAGCGTTCTT
TTTCCAGCTTTCAATTGCTCATCCCTTGTATGTTAGTGCAATTGAATGCAGCAAAGTTGGACTTCATATATGCATGTAAACTGAACTTTAATCTTATTA[
T/G]TTTCTTGGTTTTGCACTTAATGTCCTGCCCTTCTGATGTAATGGCTCCATTGCTGTCTGTGGCATTTAATTTATGAACTCTTTAGAAAAGAGTTTT
ACAGCTGGAAATCTGCAGCTCAACTTTGTAGTTTGGATAATTGCTTGTTTATTTTACTTTAATGTTTCCCTTTCAGTCAATGCTCTCCCATATACAAACA
ACTTACAGTTTGTTTGAAATAACATCTCTTGAGCTGATAGTTAGAGTTATCTGGGTTTTGTTGCATTCTGTAATCTCTCAGGTATATACTCAGAAACTTG
TAAG
chr4_7024752 A R A GSVIVG01036005001 zinc finger (CCCH-type) family protein / D111/G-patch domain-containing protein
CTGCAGAGGGGCATCCAGACAGAGACTGCCATTTTTGCCAAGTGGGAGAATCACACCCGTGGAATAGCTTCCAAGATGATGGCCAACATGGGTTACCGAG
AAGGAATGGGTTTAGGGGCATCTGGACAGGGAATCGTGGACCCTCTCTCTGTGAAAGTCCTCCCACCAAAGCAATCTCTTGATCATGCCCTTGAGTCCCA
TGAAAACGAGGAGAACAAAGAAAGTAGGGGGAAGAAGCGGAGTAGAGGCGGTAAGAGAAAACGTGATAAGAAGTTTGCTGCTGCAGCTCGGGCTAAAAA[
A/G]GATAAAGAAGAATCAAGACCAGATGTCTTCAGCCTCATCAATACCCAACTTGCAATGCATGGAGAAGCTTTGAATGGTGGATCAGCAAAGAAGCAG
CAGAATAAAAGTTTAGGGGAGGGGAAGAAAGAAGACAGACGGGCTCTGGTTGCCTATGATGATGAAGTGAGGGAATTGAGAATTCGAGTTGAGAAGCTGG
AAGAAATGGTGAACCGAAACAAGAAGGAGAAAGTAGTTTACGAGGCTGCCATGAGAAAATTGAATGAGACTCGCAAAGCTTTGGCAGAGGCCGAGGCAGC
TCAT
chr4_7631202 C M C GSVIVG01036033001 Protein kinase superfamily protein
CATGGAGTAGAATTGAAACAACATGAAAAACATTAGGTGCACTACTTGTTTGTGCTAGAGAAACACTAGGAATACCCAACAGAGAATTGGATTTTAACAG
TTTCAGAAGGTGATTCATCTACTCCTTGCTGAAGGGACTTGACTCTGATTCATTGACAGCAGCATTGACCTTGGGATTTGAACGATTGCTTCTCTCTCCG
GGCTTGCTGCTCTGCCAATTTGCTGGTGTTCCATGGATTTTCCAGCAAGTTTCTCAAGTGTGGCGCAGTTTGTTACAATAATCGCATCAGACCCGTGGC[
C/A]TTTCTCCAAGCCCTTGCTGAAAACTGGCTGCTTTATTGGCAAAACCTTCAACAACATTGAGAGCAGAACTTTCAACAGTTCCACTATTAGATTTCT
TTCCCAACATTACGTGTCAACGACTTTTTGCCCTTTGAACTTCAGCAAAGACTTCGCTGATTTTAGGAAGAGGAACTCTGCCAATAATCCATCCTCTAAC
CTCATCAAACTCTACACTGAGTCCAACACGAAACTTATAAATCCTATGAGCCTCCATAGTTTGTTTGTAATGATTAGCATCATTAGTGGACTTTCATTCG
TAGT
chr4_8598176 T K T GSVIVG01033155001 glutamate receptor 2.7
ATCATATGGTTATTTGTGGTGCTGATTCTTACTCAAAGTTACACAGCCAGCTTGACTTCAATGTTAACAGTTCAACAGTTCAACAGCTTAACCCAACTAT
CACTGATATAAATGAGCTCATAAAGAAGGGGGAGCGTGTAGGTTACCAATATGGCTCTTTCGTTTATGAATTCTTGATCAAGTCGATGAAATTTGATGAG
TCCAAGCTTGTAAAGTATGAGTCACCAGAAGAACTGGATGAATTATTTTCAAAAGGTGGAATTGCTGCTGCATTTGATGAAATCCCTTACATGAAGGTT[
T/G]TCCTTGCAAAATATTGCTCCAAATACACTGCAGTTGGACCAACATACAAGTTTGATGGGTTTGGATTTGTAAGTGTTCTCTCTTAAAGTGTACAAA
TTTTCATGCAGCGGTTTCTGATTTTTTATCATTTCAGGTCTTTCCAAAGGGTTCACCCCTTGTAGCGGATGTTTCAAGGAAAGTTTTAAGCGTGACCGAG
GGAGCTAAATTGTTAGAATTTGAGAAGGCATGGTTTGGGCAAACAACCAGTTGTCCAGAGCTCACCAGCTCAGTTTCTTCAAACAGTATCGGCCTTAATA
GCTT
chr4_8891149 G R G GSVIVG01033170001 cyclic nucleotide-gated channel 14
AATCTAGCAGTGTTCAACTAGTAATCATCTGGCTCAATCGAGAAGTCTGGCTCTTCAGGCTTCTGCAGCTTGGGCATTTCAACATCCTTGACCTTTTGAG
CTCCTCGCCTTGTGTTTTTGGCAAACCTTGAAGCCAGTATGGTGACCCCTAGATGCTGCTTTGCCTGAGAAGAATTTGATTTTGTGGAGCTCCCTTCATC
CTCTTGTTCGGTTTCATCTTCATCATCTGCATGGTCATCGTCATCAGCAAAGGAGAATGACTCTCGCATGCTGAGGTTCTTTGCCATTATCCGCTTCTT[
G/A]TACCGGCGCCAAGCAGCCTGAATGAAGCAGGCTGCCCAGGTCCTCCAGTGGTGAGAGTAGAAGCGGAAAGTGTGCTGCAGCTTCTTACTATGGAGA
CGTCTAAACTGATTTGCAACAAACTTGAGATCCTCTGCTCGCAGTGCAAAGGCTTCCACCTCAACAAGGGCTCTTACTGTTCTTGTTGAAGAGGGCAAGT
TCTGAGTAATTTTGGGAAGTAATGCCCATGCAAGCAACTCCTCCCCGCAAAAATCGCCTGGCCGTAAAGTAATTGAATTGAAGAAACCTGTTCTGCCTCC
ATTC
chr4_9660945 C Y C GSVIVG01033203001 Transcription factor jumonji (jmjC) domain-containing protein
ATACAAAATAGTTGATAACTATATAAAATAAATTACAACTAATTGACAACTACACAATCAGTTGCACACAGCTGTACGCATGGCTATACATCACAGCTAT
ACATCATAGTTGTACCCACAACTGACTCTCCACCTCAAGTTGGTGCATAGATATTGCACATGCCCAACTTGGATAATGCTGCATACAATCGGCCATTAGT
AACTACATGAGTTATCATATTCACTAACTGATCTGCCCCTCTTAATGGGATTATCCCATTAGATGTATGCAACTTTTACCTGACATTAACAACAAGAGC[
C/T]GTCTCGTTAACAGAACCATAGGAAGGATTATGCGCTCAGAAGAGTCCAGTTGATAAAGCGGGGCCTGCTGCTGCTGCCATGGCAAGAAAGCGTATG
GGAAAGAAAGGACTGGACTGACAGGAGAGGGAGATTAAGAAGGTAAAACTGGAACGAATTATTTGACCTGATTGCTTTGTCTGTTTTCAAGGCCAGAGAG
ATTATAATTGTTCTAGACTCTTGAGGAGCGCTAGGAACTGTATATATCAAAGGTCAGGGGTGGCAAAAAGGACTTGTCTGGTTGAATCATTCAAGCCAAC
CTTA
chr4_10404144 C Y C GSVIVG01035204001 auxin response factor 8
TTGATCTGCCAACTTCACAATGTCACAATGCATGTGGGTCTTTACCGAATTTAATAATGTTGCAATTACAATTGTGGATGTATTTTAGTGAGAAGGTTTG
TAAAATCTGCAAGGGAATTGATTATGTTGTGAATTATGTGTGTGGCATTTCAGGCAGATGTGGAAACTGATGAAGTGTATGCACAAATGACTTTGCAGCC
ACTTACACCGGTAATCTTGAGTTTCTAGTTCCAAATTGAGTTTCAGTTGTGATGTTTAATTATTTCCTTGAGTTATATTGAGTTGGAAAATTGTTTGTT[
C/T]TCTGGTGTATACAGCAAGAGCAAAAGGATACATTTCTTCCTGTGGAGTTGGGTATCCCGAGCAAGCAGCCCACCAATTACTTTTGCAAGACTCTCA
CAGCAAGTGATACTAGTACCCACGGGGGGTTCTCTGTTCCTCGTCGCGCAGCTGAGAAAGTTTTCCCTCCATTGGTAGTCTCCTTTCTTATTTTCTTTGG
TTTGATGCTATTCTAATACTGATTTACATTTTAATATTTGGGTTCACAGGATTTCTCTCAGCAGCCTCCAGCTCAGGAACTTATTGCAAGGGATCTCCAT
GATG
chr4_11092849 T Y T GSVIVG01035239001 ARM repeat superfamily protein
ATGAATACAAACCATATTCTCTGGTATTGTTGTATCTTGGTTAAGAGGAAGTCAACTAAATGGATAATGAGGCTTCCTGGTTGAGGCCAGAGCAAAGCAG
CTTGAGAGGAAGGTCTTTAGGTGGAGTGATGCAGTGTATCCCAAGCATGGATTTCTCTCAGTAGGATTTCCAAACTGAGAGAATCAATAGTCTGGATTTG
AGGTTAATTCCGCTCCAAATGAGTTACCTTTAGCCTTACATAAGGATCTGAAAAGAATGCAAGCAGCTTGGATATAATTTTAATCCCTGGATGCTTGGT[
T/C]TGTTTAGGGTCCACTAGCTCAGAAGTGTAGAACTGTACAACTAGCTTACAGCTATATTGGCAGGTTTTGTTGCTGATGCAGTGCTGCCATGTTGAG
GGTGGCACTCATCCTAGAGCCTTTGACAAATCCTTATGTCTTAAGTTGGCTGAAAGTCTTCTAATATGTTTTGTATACACCTGGTTACACACACCTTGTC
TATCCAGAGCCAATACCCCAGGCTATCCCTTCGGTTTAACATTCAGGGATGATTGCATCATGAACTAGTGCAGAGTTTGTATTAATACCCCAACCTTCCC
TTCA
chr4_12174593 T Y T GSVIVG01001480001 Haem oxygenase-like, multi-helical
AGAAGTGGATTGACAACTATTCTTCTGAAGGTTTCCAGGTTTGTACTTAGCAGTGAGCATTTTTATTTTATTTTAAAATTGTCTAACTGTAAATCTCTGC
TGACGCCATTCTGAGAGAAGTATACTTTACATAAATGGTTTTCTCACTCAGGCAGCTTAACTAACTTGTTCTTTGAATTTAGGGTTCAGCTTTACAAACT
GAGGACTTGCTGGATAAACTAAGTGTCTCTTTGACAGGCGAAGAGCTTGACATCATAGAAAAGCTTTATTACCAAGCTATGAAACTTGAAATAGAGTTC[
T/C]TCTGTGCTCAGCTGCTTGATCAGTACACTATAGTTCCTCTAACTAAAGGGCATGACCCTGCAGCAGATCGTCTTGTGATATTTTCTGATTTTGATT
TGACATGTACAGTTGTTGACTCTTCTGCCATTTTGGCAGAGATTGCAATAATAACAGCACCAAAATTTGATCAGAATCAACCTGAAAATCAAATTATTCG
GATGTCCTCAGCTGACTTGAGGAACACATGGGGTGTTCTATCCAAGCAGTATACTGAAGAGTATGAGCAATGTATAGAAAACATTCTGCCATCTGAGAAA
GGTA
chr4_12232042 A M A Intergenic
AGTCCACACACACCCCATGGCCACCATATGCAACCCACACCTCCCTCACAGCACATACACAACCCATAGGTAGTCCACACACACCCTATGGCCACTATAG
CCACCACATGCAACCCGCACCTTCCTCACAACACACACACACACAACCCATAGGTAGTCCATAGGCACTCCATGGCCACCATGGCTACCACATGCAGCTC
GCATCTTCCTCACATCACACATACAACCCATAGGTAGTCCATAGGCACCCCATGGCCACCACATGTAGCCCGCACCTTCCTCATAGCACATACACAGCC[
A/C]ATAGGTAGTCTACATGCACCCTATGGCCACCATGGCCACCACATGCAGCTCGCACCTTCCTTATAGCTCACCCATGCATACCTCACCTTCACACGC
TCACCCACATGCAGCCCACACACCTCATAACTCACCCATGGTCTCCACGGCTCATCCAAAGCCACCCCATGCATCCCCATCTCACCACAGCTCACCCATG
GCCTCCTCACCACCACCATGCACCCACAACCACCCTTAAGGCCACCATATAATTGATCTTTGGTAGTTGAATTTTTTATGAAGAGTTATGAAATTTGTGG
CTGT
chr4_13217297 A R A GSVIVG01026304001 polyamine oxidase 4
TCAGCTGGAATTATGGCTGCTGAAAACTGTCAAAGGTATATCTTGGAGAGACGGGGAAACTTGGAAAAGCTCCAGCTTGTCTCTCTTAGGAGTGCAATTC
ATGAGGCTGCAGTCCCCCTCCAGATATCAAGGATGTGAAACATATACATTCAGCAACTTGAAAAAAAAGAAAAAAAAGAACAGGTGCTATCCTTTAATTC
AGTGTTTTTAACTTGTATGCTCCGCTGATACTGTGGAAAACCTTTCTTTCATTCCTTGGCTGCACAATCCAGCAGTGTGAAATTCCGAGTTTCAAAGAG[
A/G]TGCTCCTATTCTTATTTAACTTTGTGGTTGGCACAGCTTTCGCTCGTTTTTTATGTTCCTTTATTTGCTGCAATTTACGTTTCTATTTAGTATTTA
CATGGAATTACAATCTTTAAGAGCCTATGGTGAAATATAAATTCCAAAGTGAAACTGCATCTCTATCCTTCTTCCCCTTTGAATACCCTACTTGACCAAC
ATAAAGTTAGAAGAAAAAAATAAATATATAAAGAGGAAAAATAGAAGGAAAGAGATCCATGGAAAAGTTGGAGTGAGATGTACTTGAAATCTTCCTCTGT
TTTT
chr4_15481952 G G K GSVIVG01026388001 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
CATAACAATATCCTTCTACAATGAGAAAGAGACATGCATTATTAGACCCAACAGAGTACGTAATTATATTACTAGTCTTCCTCCAGCGCCAAACCAGGCT
CCTGCAGTACGAGTTGAGCCTTTTCCTGAATGAGCTTCCATAGACTATCAACATGCCTAATCTCAGTCAATGTGGACCCAATTGCACAGCGTATGATATA
AATCCCACCCACCACTGCATGAGTCATGAATGCAGCACCACTTCCATTGACAGCCATTAGCAGCCTTGAGTTCAGTTCTGTGCCCTCCCCTTCTTCTCT[
G/T]GGCCTCAGTCTGAAGCACACCAGTGCAAACCTTCTCGGCACCACAACCTCAAATCTGGGATCTGTGGCTACATGTGCCTCGAATCGCTTGGCCAAG
TTTACATCGCTGCGTATATGGAACATGAGGTTGTCCAAGCCATGCCTTCGAATCACCACCCAAACTTTGATGGCCCTGAATCTTCTACTTAGTGCTATTT
GCCAATCTTTGTAGTCTATGACCTTCTTTGATTCGCTTGCATTGTTCCTCAGAAACTCAGGAGCAGTTGATAATGAATCCACAAATAGCTTTGGTTCTTT
AATC
chr4_15703114 A G R GSVIVG01026406001 Protein kinase superfamily protein
TATCAGTTGTCTGAATAATTTCAGGTATGGTTTCAATTTCTGAGAAATTCATACAAGATTTTTACCTAGCCAGAATCATAGTTGGTAATTTTTTTCCCTC
TTGATGACCAGCCTGAAATTTGAGTCTACTCTTGATTTTGCAGCTATGGAAGGAGGAATATACGTGGAAGATTACCTATCCAGAATGATCCAGGTTGCTC
CTAGTTCTCCGGCTTTTGTAGCAACCGCCCCCATCTCTGCATCAGCTAGAACTTCAGCTGCAGTTTGGACCTGTCATCCGATGATTGATCATATAACCC[
A/G]ACAACAATTGTTACAAAACAACACTGTGAGAAGGAAACACCCCCTGTACCTGCTTGACATTGTGGGCTAAACACAGTTGCTGCATCATCTGAACAC
AGACACCGTTGATTCGATTGGATGCATCATCCTGAGCTCTATTAACAAGGCCCGCCTGATCAGATGTTGAACTCTCCTCCTGCCTAAGACCCAGTTTCTT
TAGCAGACCTGAAGCAACAAAAAGAATCAAAACATGGAAGACATGGCTAACAAAACTGTCCAAACCAAGCAGAAAGGAGAAATGGAAACCTACAAGAAAG
AAAC
chr4_17485061 T Y Y GSVIVG01019038001 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein
GGAAAACTGAAAGAAATACACGAAATATTACAAAATTAAGACTTTGAAATCAAACCGACCCTACCATACTGTAAATGCCATCAAAAGCTTTCACTATAAT
TTTGTTATCCTGCACCATTATTAGACGATTCCCAGGCTTGTGAAGAGGCCAAGATTCTTGATAGGGATTGCACTATCTCATCCATGTCTGGGCGACCTGC
TGGAGCTTTCGTTAAGCAGCTATCTATCAATCTGATCATAAAAATGGCAAGTTCTGGAGGATAATTCCCATCTAAAGACGGATCTATGAAGTCCCCCAA[
T/C]TTCTCCTTTCCGTCATCCTCATGAAGCACAGCAGCCAAGACCTCTGATAAGTGTATGCTTTCCCCTCCATATAGAGCGGCAACTTCTTTCCCAGTA
AATATCTCCAGCATGAGAACCCCAAACGCATAGACATCGAGCTTTGTGGAGATCAAACCATTCTCCAGATACTCTGGAGCCATGTAACCCTTTGTCCCAA
CGATGTGCCTCGTCAAGGCAAACTGACCTTCCTGCCCCTCTGCTGACCTTGCCTGATCAAAGTTAGCAATCTTAGCCCTGAAATCCCCATCGAGAAGCAC
ATTA
chr4_17568372 T T Y GSVIVG01019031001 GNS1/SUR4 membrane protein family
GCCGTCTACAGCCTCTCCATGGCCTTGATTTCAGCCGTCATCTTCACCGGGACCCTTTTCTCCGCCGCCGCCGAGATCCGGGACACCCGGTGGTTCTGGC
GGAGGTCCAAGACCCCATTACAATGGCTGCTGTGCTTCCCTCTGGGGACACGGCCATCGGGGCGGGCCTTCTTCTGGTCATACGCCTACTACCTCTCTCG
CTTCCTCCACATGTTCCGCACGTACTTCACCATATTAGAACATCGTAAGCTGGGTTTACTCAACATTTTCAATAACTTAATGCTGCTATGCATGTCGTT[
T/C]CTGTGGCTTGAATTCTCACAGTCATTCCAATTAGTGGAAATCATGTTGGCCACCCTGGTGTACTCTGTTGTATACGGCTACAAGTTCTGGACGGCA
ATCGGGCTGCCCAGTACATGCTTCCCATTTGTGTTGAGCTGCCAGATGGTTTTACTGGGCTCTAATGTCCTCTGCCATGTGGGGGTCCTTTTACTTCACT
TGAGGAAAGGTGGCTGTAATGGAATTGGGGCCTGGATCTTCAATTCTGTGCTTAATGCTGCAATTTTGCTTCTTTTTGTTAACTCCTTTGTCAGGAAGAT
GCAT
chr4_18532108 C Y C GSVIVG01018938001 Galactose mutarotase-like superfamily protein
TTTCACCTTGTTTTGTATTTATTTATTTTAGTTCTTGTGGTAGTGGAAGTTCTCTTGTTCAAGCTGGAGTTGTAAACTCTCTTAGATGGAGTTATGATAA
CTAAAAAAATTTTGAGTTTTGCTTCTTCCGGTGCTCGTGGATCCAATTTTGCTCTCTTTGGTTGTGTACTTTGATATTTTGGTTATCTTAAAACATATAC
TGATTATATCTCTGTTGACAGTGGAGGAATTCCACATTGTTTCCCACAGTTTGGACCTGGCCCAATGCAGCAGGTAGGGTCCTCCATCACTGTTCCTTT[
C/T]GCTAGTAATAGCCTTCATTCATCCACTTGTTTCCAGCCGTTAGGAGTTAATTGTGTAGCTCATGAGCTGTCAACTACATCATTTTGAGTGGCTGCA
TAATAATGTCACCCACCAGCTATGCCTTATGGTGATGCTGCAATCAACGCTTCACCCTAAGTGAGTGCCTTTAGTATATATCCTGGAGGGTCATAATGGA
ATGTCATGGATCTTCTACATGGATGGTTTGGCCAAAAGCATAATGGTTAATGTGGTATGCTTGTATTGAATCTAGTGACTAGTAAGCTTGTTCCCACCAT
TGAG
chr4_19181713 C Y C GSVIVG01018858001 Methylthiotransferase
CGAGACTATATTTCTTTAAGATGAAGACATATATATGAAACAATTCCATTTTAGTAAGTTTCTTTACACTGGACGAACAAGCTTCCCAATTCGAGTAGTC
ATAAAATGATCTTAGTCCCACCATGTATGTTGGACAAATTGGACGTACATCCATGCCCCAAATTGCTTATTTTTCATTCCATAGTACTTTTTTTTCAATG
AAGGAAACATCTATTAACTACTTATCGGACGTAAGATGTATCACAAGGGGTCCAAATGCAAAACGCAGCGTTTTGTGGAAACAGAGTAATCGAAGAATC[
C/T]CTTGGCTCGCCCTATCCAACGCAGTACGCACACTCATGGCGTCTCCTCTCTCATCGCTCTCGTCCATCCTCTCCCAACCTCACTGCGCCATCCGCA
TCAGACTTCCTACGCGATGTTGCTTCGGTCTTCAATCTCTCTCCCCAAAACCCCACCTTTCTTCTTCTCGCTGCAATCTTCGTACTCCTCCCCCTTTCAG
GCCCGGTTTCTCTCTCACTTTCTCGAGAAAATTCTCTCAATCCCATTCTCACCTTCCACTCTCCAACAAGTCGGAGGTTCCCAGCCTCCACTCCTTCATT
GCTC
chr4_19633781 A A R Intergenic
ATTGAGTGGGGGTCTTATTCACTCCAGCCACAACCTGATTTGATATCTACCGTGCGGTGGGAAAAACCACATGTTTTTCGAATTGCTTCTTTATTACAAT
TTTGCCTTTCTTTTTAACTGGAAAGGCGATTCAATTATTCAAGGAACAATTAAAGAAAAGCAATCTAATATCACTTCTTTTGGGATCAAATGTAAAGGAA
AGTCAGAGTGCAATTTGTCAGAAGTAAAATAATTATTCCAACTGGATGGGCTCTTTGAAGTAAAGTAGAATCTGGGCAAACCAATTGGGCTGCTTTGGG[
A/G]ACCCATGTAGGCTTGGGCAGGCCGTGATTTAGCTAGTACAAGAACAAGGCCCATTTCCAAGCCCAATCCGTTCATGTCGCCCTGTCCTTTGGGCCC
CTAAGAATTGGCCTGGGGCATGCCAGGCTGCACAACAGCATAAAGAGTAACGACACCCTAGTGGATGACGCAATGGCCTACTAGGAGTATGTTTGTCGGT
TCGAAAGTGGTAGATGAACCCGATAAAGGATGACATGGGGAACCTAATCCACCTTGCCAAAACCTAATACACTAAAAATATATTAATCTACAAATTACTA
TGAT
chr4_21086677 T K T Intergenic
AAATTTGATGTATAAATAAATAAGAACGTTGTCCTAAGGCCCAGAGACAAAATTGTATGCCATATTAGACATGGCCGCCTCCCACCATCTTTGAAATAAG
TGAACTCACCATGACCAAAGCAAATGCCCATGTCTTTTCTCCACTTGCGTGTATAAGGTTCCCGTAATCGAATTGGCAATCCAAGACCATACATGGTGGT
TGTAAACATGATTTGACTTGGAGGAAACTTTTTGCCAGCCAAGCTGCCTTTTTAAGAGTTTGCCCTTCTAAGAGTTTTGCCTACGATAGACCGCAATAC[
T/G]CCTGCAAGGAAGTCAGCAAAAGGACCCCGACACATCACTTTGGAAAGCATGATCTAATTGTGGATTGTGGATTGCTCTATCTGACATGATTCCAGC
AGCCGGCAGCTCCACTATTATGAGGGCGCCTCTGTCAGAAATCCCTTTTTGTCTATAAATACTCATATGGTTTGAACCAGAGAGCATCCAAACAGCCTCC
CCAACAGCTTCATTTGCTTCATAGATAGCCATTGGCTTGAGCTATAAACAGCTTTTCAGTTGGTATATTACATGGCTAGTGGGAAGTTTTGGAATGTCAT
GACA
chr4_22484721 T Y T GSVIVG01026504001 RNA-binding (RRM/RBD/RNP motifs) family protein
CATAAACATATGTGGAGATAAACATTTGTGAAATAAAGAATTTAATCCCAAAAAAAAAAAGGGAAATTAAATTCATCATCTTGAAAACACCAAAATTTGA
TGTATTCTTGGATTTTCTTTTAGATACAATCAAGATGGGTGGTGGGAGGATATTTTTTTGGCTCCCTTTAGCTGCCCTTGCATTAGAATTACCTGAATTG
CAGCAGTTGTGGTCCTTTCCAGAATAATGCCAATAGAATTGTGGTCTTTTACAAACCTGAGCCCGTAAACAACTTAGTAGTTTGAGCTTTGATTGTCTA[
T/C]ATGGAAATTTCTTCTCTAATCAGCAGCCAAGTTAGGCAATTCTGTAGTATCTGCTATAATTAAAATGGGAACCACACTAAGGTTCAAGCTAGACAG
TGGTTGGCTATTCTAAATTTTTGTGTATCTTTAGGGATTTTTGGAACACAATCAATCTTTTTTCCTTGTAAATTTTTTTGCAGATCACCAAGGGGCCATC
GATCCAGGAGTCCCAGGAGGAGATACTAATGTTGATGAGTTGTGTGTTCTATTTTGAGGGTGTGGATCTTCTGTAAGAGATTTGAGAGTTGACATTTGTT
CTGA
chr4_23534544 A R R GSVIVG01026448001 RNA polymerase I specific transcription initiation factor RRN3 protein
TGTCTAGTTAGGTCAAAGATTTTCGTCTTTTCTTTTTGCCTAGCTCTTGGGTGTTGTTTGTATACTTCGTGTGTACTTTTTTCGCCACTTCTAGGCATTA
CTAGTACAAACTTTTATTTACCTATCAAAAAAAATAAAATAAAATAAAATAAGAGCCTCTTTAGGGGATTTGCCATGCAAATGATCTTCCTTGCACTGTT
AGAATAATTTATAATTTACATGTAGCAGCCAAGGCTTTTATTTTTTGTAAACTGATGTGGAGATCACTAGCCACACTTTGCAGGACTGGGAAAAACCAC[
A/G]GTTACATGACCCCTCCCCCTAGAGCTGCATAATGGGTAAGCCAGGCCTCAAACTTGAGACCTCTAATCTGGGAATGAGATCATCTATGAGTTGAGC
TGTCCATGGGGGCAATTTATGTAACTATGGCTTTGTTGGTTTGAAATTAACAATTAAAACAAATAATCTAAGCCAAGGGTCCATATAATTGTATTCTTAG
TTTCATGCCCTCTCCCTCTCAACTTGAATCACCTTTTTCGTGTTCCTTCTTTTGTTATAACTGGTATTTTGGATGCCTTTGAACTATGGATCATGACGTT
TTTG
chr4_23597803 G R G GSVIVG01026444001 hydroxy methylglutaryl CoA reductase 1
TCTTAAACCCTCGGATGCACTGCCACTGCCTCTCTACCTTACAAATGGGATATTCTTCGCCTTGTTTTTCTCCGTGGCCTACTTCCTCCTCCACCGTTGG
AGGGAGAAGATCCGTACGTCAACTCCTCTGCATGTTCTCACCCTCTCTGAAATCGCTGCCATCGTTTCCATGCTGGCGTCTGTTATCTATCTGTTGGGTT
TCTTTGGCGTGGACTTCGTCCAATCTTTGGTCACCCGGCCTTCGGGTGATGTTTGGGACGCGGAAGACGAGCCCCACGGCGCCATCCTCGAGGAAGACA[
G/A]TCGACCCGGGCCTTGCGCGGCAGCCATTGATTGTTGTCCGCCTCCGAAGGTGGCCGATGTTGCTCCTGTGACGGTTTTTTCGTCAGAGGAGGAAGA
GGAGATGATCAGATCGGTGGTGGCGGGGTCTGTTCCATCCTACTTGCTCGAGTCAAAACTGGGTGATTGTAAGAGAGCGGCAGCGATCAGAAGGGAGGCC
TTGCAGAGGACCACAGGGAGGTCTCTGGCGGGGCTGCCCTTGGATGGGTTCGACTACGAGGCGATACTGGGGCAGTGTTGCGAGATGCCGGTTGGGTACG
TGCA