Home >

Resource Information


교배실생 GBS

TanoRed X Ruby(seedless) 교배실생 150개체 GBS data를 이용하여 만든 Genetic map


Genetic Map viewer


Chr No


MarKer ID Ref. Tano
Red
Ruby
seedless
Genic
Intergenic
Descript Flanking Seq.
chr4_1115913 G R G GSVIVG01035414001 protein kinase family protein
TGCTCACATAGTTTCGATCTAGGAGGATGTTGGCTGGCTTTAGGTCTCTGTGCACAAAAGGCTCTGGCTTTGCCTGGTGGAGGAATAGAAGTGCAGTGGC
AATCTCTGCTGCTATTTTGAATCTCATTCTCCATGGAATTGATGGGGTGTCACCTCTTCTCAAAAGCCGATCTTCCAAGCTGCCATTGCTCATGTATTCA
TATACCAGGCATCCATACTCAGGACAGGCACCTAGGAGAAGAACCATGTTTGGATGTCTCATGCAGCTTAGAACCTCAATCTGTAAAGGAAAAGATAAC[
G/A]TTAGAATGGTCAACCAAACATGGAACTAGGAAGAGGGTACTAAGCATTAGTACCTCCTGTTGGAATTGCCTCATCCCTTGTGCAGCATCAGGTCTC
AAAACTTTGATGGCAACAGGGGTATGATCAAGTTTGCCTCTATAAACTGGGCCATATCCACCTTCCCCAATTTTCATGGCCTGAGAGAATTTCTCAGTGG
CTACTTCAATCTCTTCTATGGCGTATTTCCTATAGCGGACATCATTATGAGCCAAAGCAGTCAATGCCCGTGCCTTCTCTTCCGCCTCCCTTGAAGCCTT
CAAC
chr4_2009468 C Y C GSVIVG01035523001
ATCCTTGATCTGAGACAACCCCTCTTTCATGGCCTCCAGCTTTGAGACATGTAAAAGTAGTCCCTTCTCAGCAGTTCTTAAACACTTGAGGAGGTGGTTG
AACATCACCAGAACTTCTCCCCATTTACGAGAAGGGGATTCGGGTGCTCTTGCAGGCGCAGGCCGCATCCATGAAGTAGAGTCAGGATCATAGGAAATGG
CCTTATCAGCTAAGAAATTCAGGCAGCTCAGGACTATTTGCTGCCCCATCATCATCCCTTTGCCTGGAGGATGACGTTGATGATCCAGAGACTCCATCT[
C/T]GGATTTCAATCCATTCAGTATCTCCTCCAGCGCACCCACCCATATCCGATGCTGTGTGACTTGTGAGCATACTGTGAAACGTACTTCCTTCCTTTG
CTGAGCAGAAATGTTCAAGAAGTTGCAGACTTTAGTCAGTGAATTCACAGTCATGGGCTCCCTTTCATTCGGTTTACCGAAACAATCAGGCAATGTGCAT
TGCCCAGCTGCCAGTGATGCCATATTCTTCTTCACTGCTTGCTGCATCAATGGAGACCCAAGAAAAGCTCGAGCGAGCGACTTGAAAGTCTGCATTCTTT
GTTC
chr4_2016632 G R R GSVIVG01035525001 H(+)-ATPase 5
TATTTCACCCTGTTTACAAGTTGAACCAGAAAATACTTCATCCGAAGGATTCTTGGTGACAGGGAGGGATTCTCCAGTAAGAGCAGATTGATCAATCTTA
AGGGGATCACCCTCAAGAAGACGGGCATCAGCGGGGACAATATCACCCAATTTAATGCTAATTATGTCTCCTGGAACAAGAATAGCTGCATCCTGCTCAG
TCCATCGTCCATCCCTAAGAACCTACATTATGTCACCATAAGAAATTAACAAAACCTAAGAAATAGGAACAGGACAAAGTTATAACTTTGAGCATGGTG[
G/A]TATTTTTACCTTCGTCTTGGGAGCAAGGCCAGCCATTAGGGCTGCTGCTGCATTACCAGCATTGTTTTCTTCAATAAAACTGATTGTGGAGTTGAT
CAACAGTAAAACAATGATACCAACAAAGTCTTGCCAATCTGGAGGCTGGCCACCACCATTTGCTAAGGCAATAGCCATAATAGCTGCGGCTTCCATAACC
CATGACAGAGGATTCCACATAAACCCCAAAAACTTGAGGACTTTGCTCTCCTGTTGGCGAAACATTAAGCCATCATCTTCATCACCATAGGGATTAAACT
AACA
chr4_2515800 A W A GSVIVG01035584001 Protein kinase superfamily protein
ATTCCTATACCTTCCAACCCCTCCTATGACCAATTGACCAAGTAATACCTCACCCCACTCCAAAGGAAATTTCATTGAATCTTCTCTAACCTAATACGTT
TCTGGCTAGGGACCACAAATAGATGCATAAAATAGACACTAAGTTAAAGAAGGTACTTTTAATAAGCGCAAGTTTCACCCTTAGATAAGAATTTTCTTTC
CACAAAGCCAATCTTCTCTTAAACCATTATTCATCAAAGTACCAAGCTGCATCTAACTTGAATGGAGCACCAAAGGAAGACCCAAATGACAAAACAATC[
A/T]TTTAAAGAGAAGACTAGGATATCATATCAATAAACCAACATAAACTTTCAAGCGTATGCAAAAGTTTCTTAGCTGTGCAATTCAATAAGAACCAAA
TATTAGCACCCGATCCCTTTTAGAGGCCATGACACTATGGCCAATATTTAGCACAATTCTCCAGGGGCACATCTAGTAGTAAATGAATAATAAGATGGGA
AGAACGTGGAAGAGGAACATATCAATTGTGAACCAACCAAGAGTCCCCTCCCAACACCAGGACAATCACCCAAATAAACACGGATCTACCCCTCACAACC
CTAA
chr4_2538543 T A W GSVIVG01035587001 DDB1-CUL4 associated factor 1
TTCCCGATGTCTGGCTGCCTGAATCTCGGATTAGTTCTGATAGCTTTTTCCCAACCTAATGCAAAAAAAAATAGAAAAATATAGTAAACAATAATAACAA
CAATAATAATAAATATTCATAACAATAAAATCATATACAGAGTATAAACTAAAGCAAATAAGGTAAGGAAAACTGAAGAGGCTCTCAAGAATTTTGAATG
AAATATACAGCAGGTCAACCCAGAATGGAAAGAATTCCAATACATCTTAACCTTCTACAGGAATGCAGCATCTTCCAAATAAATCCTCGCAAACCATAA[
T/A]ATACCTCTAGTTTGAATAGGCCCACACTAATTTCATGTATAAGTACAAAAGAATTCACTTCAAGCACAGAAGTTCAGGTTTTCTGGCAGCAATATG
TTCAGTTTTGCATCACTGTTCACTCCCCTTTCTTGATAGGTGAGCAAAGGGTATTACTAGGCACAGAGGAAAAGGTGGGGTGAGGGGTGGGGTGGGGTGA
ACATTAATGAAAATTGAACATCTTGATCCTCAAAAACCTGAACTGTTAATCCGTAAATTTCTGTGTATTCTTATAACAATGTTTTAGACCTAGACGCATT
AACA
chr4_3692658 G K K GSVIVG01035726001 Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein
AGAGAGATAATGCTGTTGAACTCTATCTCTCGAAAATAATTATTATAAGAAACTCTCTTGTTCAGCACTTCTCATTGCTTTTTTGTCTCACAAGATGTGG
CAGTCACAACTCCATATCTGTTTCTCTTCATTCAACTGAATGTTAATATGGATTAGGTCGTTCTATTGTTATCAAATATCCTTGAATTCTAGGAAACCTG
ATTCTTTATCTCTGCTTGAAGGGTGGAATCGAGAAAGCCAGAACGCTATTCGTCAGCTGCACCACTGTCTCGTAAGTGTAGTATATATTTCTCATGGAA[
G/T]TTTCACGGAAGTTTGAAAGTATGCCTATTGTTATAAGATTCATCAAGCTACCTGTGCCTTTTGGATATGCTTGGAAATATTAGTGACTGCTGCAGT
GTTATCTTTCAAACAATTTGAGCATTGTTTACATGCATCTTATAAGAAATAACTGGATATTGTTACGATGTAGCTGATGCACGCCTGCGCATTGTGTCTG
AGCGTGTTGACATAATCGATAACCTCATCATTTCTGTTACCGTAAGTTTGATAAAACCATATGCTTGTTGCTTGCACTTCCTGTTGGTTCTTTCATGAAG
ATTA
chr4_5067251 G G R GSVIVG01035869001
GCCCTCTTCGAATTCAACCTCACCCTTCCCATCATGATGGCCCAGTTCCTCCTCCTCATGGTCGCACTCGACAAGATCTACTACTCTCCCCTCGGCAAAT
TCATGGACGAAAGAAACGCCGCTATCAAGGAAAAGCTCAACAGCGTGAAGGACACTTCCGGCGAAGTGAAGCAGCTGGAGGAGCAGGCTGCGGCTGTGAT
GAAGGCGGTGAGGGCGGAGATATCGGCGGCCCTCAACCAGATGAAGAAGGAGACGGCGGCGGAAGTAGAGATGAAGCTGGCGGAGGGGAGGAAGAAGGT[
G/A]GAAGCGGAGCTGCAAGAGGCTTTGGCCGTTTTGGAGAAGCAGAAGGAGGACACCATCAAGGCTCTTGATTCTCAGATCGCTGCTCTGAGTCAGCAA
ATTGTGAACAAGGTCCTTCCCCTCTGATCTTTTTTTTTTTTTTTTCCTTTTTCCAAATTTAATTTTCATGGCCATCATGGGAAACAAATTTAATTTCCTA
TTATAATGGATTTTGTGTAGCATATATATAATTGCAATGTAACCATCTACCCATGTGGAAATTTTTGGGGTCACTTCCAAATGAATGACAAATATGGGTT
GATG
chr4_5225959 T C Y GSVIVG01035882001 sucrose phosphate synthase 2F
ATTTTACTTTAATTGGCAGGCATTATGTCAATCACATAGCAGTACAGCATATTCATCTTTCATCTCAATGATAAAATGCATGACACGAGGGACAGATATG
TGTGCAGTGCAGAGAAATGTAATGAAATTCATGACCATATCCATACTTCACCCTTGGGTATAGAGGTGCAGCGGAAGGTGGGGATGAACTAAAAGGACTC
CATGGTACATCAGACAAAGGTGCACCAGTATGAGATGGGTTGACACTATCCAAATGTAAATTTCACAATTCACACAACAATGGCAACCAGGATATATAC[
T/C]TGTGCTTATGTGGTATTATTTATTGAAGTACAATCCTGTTCTCAGTATCACAAAGAATACCTTTGTTTTTGCTGCCAGATGGTAAATCTCAGGAAC
TTCAGACTGCTTGTGATGTTTAGGATAAGCCACTTGGCCATACATATCATATTTGTCAATCAGCTTAAGTATTGAAATAAGAACAGATGCATTTGTGCTA
GACATTTCATCGATGTCATCACGGTTGCCCATTATTAATGTCTGCAACAGTAGAAATTGCAAAATCACTGGCATAGAACCCCAAAGAAAAAATGAGCCGT
TTCA
chr4_6540279 T K T GSVIVG01035963001 nuclear RNA polymerase D2A
TCAATGAGTTGTTGTTTCTGATAAAAGAAAGCCATATTGTCAACTAGGAACTCAGCTTTAAAAACTATGATATGGAATCGTGTGGTTATCTTGGTGGTAG
TTGGTCTCTGGTGCACATAGAACTTCTACATAGAAATTTATAATAACATATGCAATGTTATGCTTTATGACTAAAGCTTATGTATTCAAATAGCGTTCTT
TTTCCAGCTTTCAATTGCTCATCCCTTGTATGTTAGTGCAATTGAATGCAGCAAAGTTGGACTTCATATATGCATGTAAACTGAACTTTAATCTTATTA[
T/G]TTTCTTGGTTTTGCACTTAATGTCCTGCCCTTCTGATGTAATGGCTCCATTGCTGTCTGTGGCATTTAATTTATGAACTCTTTAGAAAAGAGTTTT
ACAGCTGGAAATCTGCAGCTCAACTTTGTAGTTTGGATAATTGCTTGTTTATTTTACTTTAATGTTTCCCTTTCAGTCAATGCTCTCCCATATACAAACA
ACTTACAGTTTGTTTGAAATAACATCTCTTGAGCTGATAGTTAGAGTTATCTGGGTTTTGTTGCATTCTGTAATCTCTCAGGTATATACTCAGAAACTTG
TAAG
chr4_7631202 C M C GSVIVG01036033001 Protein kinase superfamily protein
CATGGAGTAGAATTGAAACAACATGAAAAACATTAGGTGCACTACTTGTTTGTGCTAGAGAAACACTAGGAATACCCAACAGAGAATTGGATTTTAACAG
TTTCAGAAGGTGATTCATCTACTCCTTGCTGAAGGGACTTGACTCTGATTCATTGACAGCAGCATTGACCTTGGGATTTGAACGATTGCTTCTCTCTCCG
GGCTTGCTGCTCTGCCAATTTGCTGGTGTTCCATGGATTTTCCAGCAAGTTTCTCAAGTGTGGCGCAGTTTGTTACAATAATCGCATCAGACCCGTGGC[
C/A]TTTCTCCAAGCCCTTGCTGAAAACTGGCTGCTTTATTGGCAAAACCTTCAACAACATTGAGAGCAGAACTTTCAACAGTTCCACTATTAGATTTCT
TTCCCAACATTACGTGTCAACGACTTTTTGCCCTTTGAACTTCAGCAAAGACTTCGCTGATTTTAGGAAGAGGAACTCTGCCAATAATCCATCCTCTAAC
CTCATCAAACTCTACACTGAGTCCAACACGAAACTTATAAATCCTATGAGCCTCCATAGTTTGTTTGTAATGATTAGCATCATTAGTGGACTTTCATTCG
TAGT
chr4_8005927 A R A Intergenic
TGTGGGCTCCATGGTGGCTGTGTGAGTTGTGCGGGCTATGTGGTGGTTGTGTGAGCTATGTGGGCCGCATGGTGGCACAAATGGGAAGTGGTTGGTGAAG
ATTGGCAGCTTTGGGACTAAAGTCGGATGGTGTTTCAGTGGTGGAATGAGTGAAAGAAGTAGTGAGAGAGGTGGGTTTGGTAGGTATAGAAAATGAGGAT
ATGAATGGTGATGGGTATGGGAGGCATGAAGAGTGGCCATGAGTGCATAAATCCTATGGGCATGGGTAGGAAATGGGTAGTAGGGCAGCAGGTTGGGCA[
A/G]GTGTGAAGGAAGTAGGAGGTGAAAGTGTGGTGATGTGTTTGGTGGATGGGTTGAAGGTAATAGGTATGGAAATGAAGGTGGCCACACGCGTTAGAC
TCCATGTATGTAAGAAATAATGGAAATAAACTGAAGGTGGATTAGATGGTGTGGTTGGGGAGCATGTGGGTTGTGTGTGGTGGCTATGGGGTGGCTGTGG
GCTGCATGTGCTGGATATGATGGTCATGGGGTGGCTATGGGTTGCATGTAGTGGTCATAATCAGGATGATGGGGGATGATGGTGATGTAAATGGGGGAGT
AGTT
chr4_8891149 G R G GSVIVG01033170001 cyclic nucleotide-gated channel 14
AATCTAGCAGTGTTCAACTAGTAATCATCTGGCTCAATCGAGAAGTCTGGCTCTTCAGGCTTCTGCAGCTTGGGCATTTCAACATCCTTGACCTTTTGAG
CTCCTCGCCTTGTGTTTTTGGCAAACCTTGAAGCCAGTATGGTGACCCCTAGATGCTGCTTTGCCTGAGAAGAATTTGATTTTGTGGAGCTCCCTTCATC
CTCTTGTTCGGTTTCATCTTCATCATCTGCATGGTCATCGTCATCAGCAAAGGAGAATGACTCTCGCATGCTGAGGTTCTTTGCCATTATCCGCTTCTT[
G/A]TACCGGCGCCAAGCAGCCTGAATGAAGCAGGCTGCCCAGGTCCTCCAGTGGTGAGAGTAGAAGCGGAAAGTGTGCTGCAGCTTCTTACTATGGAGA
CGTCTAAACTGATTTGCAACAAACTTGAGATCCTCTGCTCGCAGTGCAAAGGCTTCCACCTCAACAAGGGCTCTTACTGTTCTTGTTGAAGAGGGCAAGT
TCTGAGTAATTTTGGGAAGTAATGCCCATGCAAGCAACTCCTCCCCGCAAAAATCGCCTGGCCGTAAAGTAATTGAATTGAAGAAACCTGTTCTGCCTCC
ATTC
chr4_9660945 C Y C GSVIVG01033203001 Transcription factor jumonji (jmjC) domain-containing protein
ATACAAAATAGTTGATAACTATATAAAATAAATTACAACTAATTGACAACTACACAATCAGTTGCACACAGCTGTACGCATGGCTATACATCACAGCTAT
ACATCATAGTTGTACCCACAACTGACTCTCCACCTCAAGTTGGTGCATAGATATTGCACATGCCCAACTTGGATAATGCTGCATACAATCGGCCATTAGT
AACTACATGAGTTATCATATTCACTAACTGATCTGCCCCTCTTAATGGGATTATCCCATTAGATGTATGCAACTTTTACCTGACATTAACAACAAGAGC[
C/T]GTCTCGTTAACAGAACCATAGGAAGGATTATGCGCTCAGAAGAGTCCAGTTGATAAAGCGGGGCCTGCTGCTGCTGCCATGGCAAGAAAGCGTATG
GGAAAGAAAGGACTGGACTGACAGGAGAGGGAGATTAAGAAGGTAAAACTGGAACGAATTATTTGACCTGATTGCTTTGTCTGTTTTCAAGGCCAGAGAG
ATTATAATTGTTCTAGACTCTTGAGGAGCGCTAGGAACTGTATATATCAAAGGTCAGGGGTGGCAAAAAGGACTTGTCTGGTTGAATCATTCAAGCCAAC
CTTA
chr4_10404144 C Y C GSVIVG01035204001 auxin response factor 8
TTGATCTGCCAACTTCACAATGTCACAATGCATGTGGGTCTTTACCGAATTTAATAATGTTGCAATTACAATTGTGGATGTATTTTAGTGAGAAGGTTTG
TAAAATCTGCAAGGGAATTGATTATGTTGTGAATTATGTGTGTGGCATTTCAGGCAGATGTGGAAACTGATGAAGTGTATGCACAAATGACTTTGCAGCC
ACTTACACCGGTAATCTTGAGTTTCTAGTTCCAAATTGAGTTTCAGTTGTGATGTTTAATTATTTCCTTGAGTTATATTGAGTTGGAAAATTGTTTGTT[
C/T]TCTGGTGTATACAGCAAGAGCAAAAGGATACATTTCTTCCTGTGGAGTTGGGTATCCCGAGCAAGCAGCCCACCAATTACTTTTGCAAGACTCTCA
CAGCAAGTGATACTAGTACCCACGGGGGGTTCTCTGTTCCTCGTCGCGCAGCTGAGAAAGTTTTCCCTCCATTGGTAGTCTCCTTTCTTATTTTCTTTGG
TTTGATGCTATTCTAATACTGATTTACATTTTAATATTTGGGTTCACAGGATTTCTCTCAGCAGCCTCCAGCTCAGGAACTTATTGCAAGGGATCTCCAT
GATG
chr4_11092849 T Y T GSVIVG01035239001 ARM repeat superfamily protein
ATGAATACAAACCATATTCTCTGGTATTGTTGTATCTTGGTTAAGAGGAAGTCAACTAAATGGATAATGAGGCTTCCTGGTTGAGGCCAGAGCAAAGCAG
CTTGAGAGGAAGGTCTTTAGGTGGAGTGATGCAGTGTATCCCAAGCATGGATTTCTCTCAGTAGGATTTCCAAACTGAGAGAATCAATAGTCTGGATTTG
AGGTTAATTCCGCTCCAAATGAGTTACCTTTAGCCTTACATAAGGATCTGAAAAGAATGCAAGCAGCTTGGATATAATTTTAATCCCTGGATGCTTGGT[
T/C]TGTTTAGGGTCCACTAGCTCAGAAGTGTAGAACTGTACAACTAGCTTACAGCTATATTGGCAGGTTTTGTTGCTGATGCAGTGCTGCCATGTTGAG
GGTGGCACTCATCCTAGAGCCTTTGACAAATCCTTATGTCTTAAGTTGGCTGAAAGTCTTCTAATATGTTTTGTATACACCTGGTTACACACACCTTGTC
TATCCAGAGCCAATACCCCAGGCTATCCCTTCGGTTTAACATTCAGGGATGATTGCATCATGAACTAGTGCAGAGTTTGTATTAATACCCCAACCTTCCC
TTCA
chr4_12232042 A M A Intergenic
AGTCCACACACACCCCATGGCCACCATATGCAACCCACACCTCCCTCACAGCACATACACAACCCATAGGTAGTCCACACACACCCTATGGCCACTATAG
CCACCACATGCAACCCGCACCTTCCTCACAACACACACACACACAACCCATAGGTAGTCCATAGGCACTCCATGGCCACCATGGCTACCACATGCAGCTC
GCATCTTCCTCACATCACACATACAACCCATAGGTAGTCCATAGGCACCCCATGGCCACCACATGTAGCCCGCACCTTCCTCATAGCACATACACAGCC[
A/C]ATAGGTAGTCTACATGCACCCTATGGCCACCATGGCCACCACATGCAGCTCGCACCTTCCTTATAGCTCACCCATGCATACCTCACCTTCACACGC
TCACCCACATGCAGCCCACACACCTCATAACTCACCCATGGTCTCCACGGCTCATCCAAAGCCACCCCATGCATCCCCATCTCACCACAGCTCACCCATG
GCCTCCTCACCACCACCATGCACCCACAACCACCCTTAAGGCCACCATATAATTGATCTTTGGTAGTTGAATTTTTTATGAAGAGTTATGAAATTTGTGG
CTGT
chr4_13019589 A W A Intergenic
GCTAAAGAGCTAGAGTCTATTTAATTGACAAAACAAAATTTCTAAATTGGTGGATTCATCCTCCCCCAAAGGCATAAAGAGGAAAGTCTTATCCAGAAAC
CATGGAATCCGCCCCTCTTAACTAACTTTCAGAAATGGGAAAATCATCGAAAAGCAGCCAGAGAAAAGCTTATCAACTATTTGCGAGAAAAGTCATGGAG
GTTTCCTCCGAGAGAACCTCAAACTGCTGACTATTTGATTTGTTGGACTTTGACTATGACGATTCAGGCGAACAATGGGGAAAAGAGCACATGGTTATG[
A/T]CAGTGAATAGAGATGCATGTGAGTGGGCGGTGGGCGCTGCATGTGATCACGTTGGCCTATATTCATGAAATGTTGCTTTCATCCAGTGCTACGCCT
GCCAGCACTGCCACATGCTGCTAATTCCTTCTGGTTTTTCTTGAGCTGGATTTTATAATTCCATCGCTCCATGTTAAAACTAAAATATTTTAAATCACAA
TACGTTTCCACCATTTGAATGCCTTCCGTAGTACAAATGTGTTGGACAGTATAGTTGGAGTAATGTGTATGAAAGAGAAATACACAATACCACTTTCCCT
TTAA
chr4_13217297 A R A GSVIVG01026304001 polyamine oxidase 4
TCAGCTGGAATTATGGCTGCTGAAAACTGTCAAAGGTATATCTTGGAGAGACGGGGAAACTTGGAAAAGCTCCAGCTTGTCTCTCTTAGGAGTGCAATTC
ATGAGGCTGCAGTCCCCCTCCAGATATCAAGGATGTGAAACATATACATTCAGCAACTTGAAAAAAAAGAAAAAAAAGAACAGGTGCTATCCTTTAATTC
AGTGTTTTTAACTTGTATGCTCCGCTGATACTGTGGAAAACCTTTCTTTCATTCCTTGGCTGCACAATCCAGCAGTGTGAAATTCCGAGTTTCAAAGAG[
A/G]TGCTCCTATTCTTATTTAACTTTGTGGTTGGCACAGCTTTCGCTCGTTTTTTATGTTCCTTTATTTGCTGCAATTTACGTTTCTATTTAGTATTTA
CATGGAATTACAATCTTTAAGAGCCTATGGTGAAATATAAATTCCAAAGTGAAACTGCATCTCTATCCTTCTTCCCCTTTGAATACCCTACTTGACCAAC
ATAAAGTTAGAAGAAAAAAATAAATATATAAAGAGGAAAAATAGAAGGAAAGAGATCCATGGAAAAGTTGGAGTGAGATGTACTTGAAATCTTCCTCTGT
TTTT
chr4_15481952 G G K GSVIVG01026388001 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
CATAACAATATCCTTCTACAATGAGAAAGAGACATGCATTATTAGACCCAACAGAGTACGTAATTATATTACTAGTCTTCCTCCAGCGCCAAACCAGGCT
CCTGCAGTACGAGTTGAGCCTTTTCCTGAATGAGCTTCCATAGACTATCAACATGCCTAATCTCAGTCAATGTGGACCCAATTGCACAGCGTATGATATA
AATCCCACCCACCACTGCATGAGTCATGAATGCAGCACCACTTCCATTGACAGCCATTAGCAGCCTTGAGTTCAGTTCTGTGCCCTCCCCTTCTTCTCT[
G/T]GGCCTCAGTCTGAAGCACACCAGTGCAAACCTTCTCGGCACCACAACCTCAAATCTGGGATCTGTGGCTACATGTGCCTCGAATCGCTTGGCCAAG
TTTACATCGCTGCGTATATGGAACATGAGGTTGTCCAAGCCATGCCTTCGAATCACCACCCAAACTTTGATGGCCCTGAATCTTCTACTTAGTGCTATTT
GCCAATCTTTGTAGTCTATGACCTTCTTTGATTCGCTTGCATTGTTCCTCAGAAACTCAGGAGCAGTTGATAATGAATCCACAAATAGCTTTGGTTCTTT
AATC
chr4_15703114 A G R GSVIVG01026406001 Protein kinase superfamily protein
TATCAGTTGTCTGAATAATTTCAGGTATGGTTTCAATTTCTGAGAAATTCATACAAGATTTTTACCTAGCCAGAATCATAGTTGGTAATTTTTTTCCCTC
TTGATGACCAGCCTGAAATTTGAGTCTACTCTTGATTTTGCAGCTATGGAAGGAGGAATATACGTGGAAGATTACCTATCCAGAATGATCCAGGTTGCTC
CTAGTTCTCCGGCTTTTGTAGCAACCGCCCCCATCTCTGCATCAGCTAGAACTTCAGCTGCAGTTTGGACCTGTCATCCGATGATTGATCATATAACCC[
A/G]ACAACAATTGTTACAAAACAACACTGTGAGAAGGAAACACCCCCTGTACCTGCTTGACATTGTGGGCTAAACACAGTTGCTGCATCATCTGAACAC
AGACACCGTTGATTCGATTGGATGCATCATCCTGAGCTCTATTAACAAGGCCCGCCTGATCAGATGTTGAACTCTCCTCCTGCCTAAGACCCAGTTTCTT
TAGCAGACCTGAAGCAACAAAAAGAATCAAAACATGGAAGACATGGCTAACAAAACTGTCCAAACCAAGCAGAAAGGAGAAATGGAAACCTACAAGAAAG
AAAC
chr4_17485061 T Y Y GSVIVG01019038001 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein
GGAAAACTGAAAGAAATACACGAAATATTACAAAATTAAGACTTTGAAATCAAACCGACCCTACCATACTGTAAATGCCATCAAAAGCTTTCACTATAAT
TTTGTTATCCTGCACCATTATTAGACGATTCCCAGGCTTGTGAAGAGGCCAAGATTCTTGATAGGGATTGCACTATCTCATCCATGTCTGGGCGACCTGC
TGGAGCTTTCGTTAAGCAGCTATCTATCAATCTGATCATAAAAATGGCAAGTTCTGGAGGATAATTCCCATCTAAAGACGGATCTATGAAGTCCCCCAA[
T/C]TTCTCCTTTCCGTCATCCTCATGAAGCACAGCAGCCAAGACCTCTGATAAGTGTATGCTTTCCCCTCCATATAGAGCGGCAACTTCTTTCCCAGTA
AATATCTCCAGCATGAGAACCCCAAACGCATAGACATCGAGCTTTGTGGAGATCAAACCATTCTCCAGATACTCTGGAGCCATGTAACCCTTTGTCCCAA
CGATGTGCCTCGTCAAGGCAAACTGACCTTCCTGCCCCTCTGCTGACCTTGCCTGATCAAAGTTAGCAATCTTAGCCCTGAAATCCCCATCGAGAAGCAC
ATTA
chr4_18007386 T Y Y GSVIVG01018993001 U2 snRNP auxilliary factor, large subunit, splicing factor
CTTGCTGCAACACTTGGTCCAAGTCAGCCCAATCCCAATTTAAACCTTGCTGCTGTGGGCCTAACACCAGGTTCTGCTGGGGGTCTTGAGGGTCCTGACC
GCATTTTTGTTGGTGGGCTCCCCTACTACTTCACAGAAGCACAGATCAGGGAGTTGCTAGAGTCTTTTGGTCCTCTTCGGGGTTTTGATCTTGTGAAAGA
CAGGGAAACTGGAAACTCCAAGGGCTATGCATTTTGTGTTTACCAAGATCTTTCTGTTACTGACATAGCTTGTGCTGCATTGAATGGAATTAAAATGGG[
T/C]GATAAGACTCTCACTGTTAGGCGTGCAAACCAGGGTGCTTCCCAACCTAAACCCGAGCAAGAGAATGTATTGTTGCATGCACAGCAGCAGATTGCT
TTACAGGTGGAAAGAAACTTCATGTTATCATCTCTATTTATTGGGAGATGTTGCAAATTTGCTGTCAATCTTAAAATTAAAATATTATGCAGTAATATTA
ATTTTGCATTTTATTTCAATGGTATTCTTGTTGCATATTATGATCAATAACAGCAAGTTGTGATGCTGCAATATTTTTTCTAAATGGGCTGTACCTATCA
AACT
chr4_18532108 C Y C GSVIVG01018938001 Galactose mutarotase-like superfamily protein
TTTCACCTTGTTTTGTATTTATTTATTTTAGTTCTTGTGGTAGTGGAAGTTCTCTTGTTCAAGCTGGAGTTGTAAACTCTCTTAGATGGAGTTATGATAA
CTAAAAAAATTTTGAGTTTTGCTTCTTCCGGTGCTCGTGGATCCAATTTTGCTCTCTTTGGTTGTGTACTTTGATATTTTGGTTATCTTAAAACATATAC
TGATTATATCTCTGTTGACAGTGGAGGAATTCCACATTGTTTCCCACAGTTTGGACCTGGCCCAATGCAGCAGGTAGGGTCCTCCATCACTGTTCCTTT[
C/T]GCTAGTAATAGCCTTCATTCATCCACTTGTTTCCAGCCGTTAGGAGTTAATTGTGTAGCTCATGAGCTGTCAACTACATCATTTTGAGTGGCTGCA
TAATAATGTCACCCACCAGCTATGCCTTATGGTGATGCTGCAATCAACGCTTCACCCTAAGTGAGTGCCTTTAGTATATATCCTGGAGGGTCATAATGGA
ATGTCATGGATCTTCTACATGGATGGTTTGGCCAAAAGCATAATGGTTAATGTGGTATGCTTGTATTGAATCTAGTGACTAGTAAGCTTGTTCCCACCAT
TGAG
chr4_19608086 T W T GSVIVG01018819001 Serine carboxypeptidase S28 family protein
CTGTGGCCTGGCACTGGGACAGCCACAGGTCTATGTGTTCTATGATCTGTTGCCTAACTTTGTGAACTGCATCAGGAGAGCTACAGTTCTTGGCATCACC
TGAAACCAAAAGGCAAGAAGATGTAAGTCCAATCATTCATAGAATGGGACTGAGGAGCAATGAGACGGCTATCTTTGCATAATTTGTCAGAATGCCACAC
AAAGCAGCAGTTCAATAAAATTTTATGGTTGAATAGAAGCAGAAGTGGTCCCAGTTCGTATGGGCCCTGTTTTGAGAATAAGTGGCTTCCAATAGCTGC[
T/A]AGAGTTAAATATTTGATGCACAAATTGATAATTCTGAATAAAACTGCCCTTGTGCATAATAGGGAAAACTAAAGTGGTTTGAATCTCACAGGAACT
CAAAGTAATGTGTCATGCTGCAATTCATCAGTGGAAGGACTGCCAAATATAACAATAATTCAAAAGTACATGTGCCTGGAATCGCAAGCTAGAACCCAAT
ATGGCGTTATCTAGAAGTCATTATTACTGAATAGAGTTCGTGATATACTAGTGATAAGAGATTTTTTTTGCATGGATCTCTTTGTGAAAGGGTGAATGAG
AAAC
chr4_20329252 C S C GSVIVG01018731001 HEAT repeat ;HECT-domain (ubiquitin-transferase)
GACGACGATGATGATGATGACGAGGACGACGGTGAGGGCAGTTTTGGAATTTTGCATCAGAATTTGACCTCTGCGAGTAGTGCTCTACAAGGTCTTCTCA
GGAAACTCGGTGCCGGACTCGACGAATTGTTGCCGTCGGCTGCCGTGGCCGCGACGCCGGGGAGTGGGCGGCTCAAGAAGATACTATCCTCACTGCGGGA
GGAGGGCGAAGAAGGGCGTAAAATCGAGGCGTTGACGCAGCTCTGCGATTTGCTATTGATGGGGACGGAGGATTCGCTGTGTGCTTTTCCGGTTGACTC[
C/G]TTCGTGCCGGTGCTTGTGGAATTGCTTAATTATGAGAGCAATGCGGACATAATGTTGCTTGCTGCTAGGGCAATTACGCATCTCTGCGACGTGTTG
CCATCATCTTGCAGTGCGGTCTTGCATTACGGTGCGGTTCGGTGTTTCTGTGCCAAGCTGCTGGAAATTGAATGTATGGACTTGGCTGAACAGGTGATTT
CTTGTGGGCACATGTAAATTCATTGTTGTAAAACATTTTATATTATTTGATTGCTGACAAAATGGAGGAAAACTACAAAAAAAAATTATGTTTCGGGTCT
TAAT
chr4_20559130 G G R GSVIVG01003838001 serine acetyltransferase 3;2
AGGTAGTCTCTTATTTGAAAATCTTTGAATCTGGAGCAGCATTATGACCATATTATATGGATTTGTGCCTTTCCTATTTCTCCTTTTAATCTGGTAACCT
TTATTTATTTATTTTTGTCTAGGTTTTTGGAGTTGACATCCATCCAGGTATGTATTTGCTCAAATTTGTTTTATTGGATAGATATCCCATTTACAATTTG
TAGCATATTTTTCATTAAGTTTATTGTAGGAGCGAGCAGCAACATTCCTTGTAAAAGGGATGTAACTTTTGAGAAACCTATGGTGAAATCAACTTAAAT[
G/A]TGTTTACAGCTTACCTGGTACTTAGATATGATTCTTGTTTCAATGAACAGTTGCTGCCATTGCAAGTCTGGAACGATCTTTTTTAACTTGTTGGTT
TGTAGCTATGCGAGATGACAAAGGTTTCCTGGATGATATCCACTATGAGATGAAATTTTTCCTTTTTAATTAAATTTGGTGATTCTGTACAGCTGCACAA
ATTGGAGAGGAAATACTTCTGGATCATGCAACAGGCGTGGTTATAGGTGAAACTGCTGTTGTAGGAAATAGAGTTTCATTAATGCAGGTAATTTGGCTTC
TATC
chr4_21844706 T W T Intergenic
TTTTGAGAACAATGGTAGCTCCAATGAGTCCATTGTGTGGTCAAGTTTGAGTGATCAATGTGATGTCAAAGGTTTCTGCGGCTTCAACAGTTATTGCTCA
AACCCTGGTGCTAAAGCTGAATGCCATTGTTTACCAGGTTTTGCTTTCAACAACCCTAGTGAGAAGATCCGAGGCTGCTCTAGGATCTTCAATGGTGATG
ATTGCAGCAAAATGAACAATCAATTGATATCATACAACATTACTACTTTAGAAAATACAGGGTGGGGAGACTATCCTTATTACAAGAAATCAATGAAGA[
T/A]GGAAGAATGCAGCAAGTTTTGCCTGGATGATTGCAACTGCGGGGCAGCACTGTATCGGAATGGAAGTTGCTATAAATATAAGCTTCCGGTCAGATA
TGGTAGGATAAATCGGAACGAGACTGCTACAGCCTTGTTGAAGGGACATTTGCAGAGGGTCAAGTCTGCATACCGTCCCCCACCTGCTCCAATGAATACA
GAAGTGAAGATTGATGGCAAGAAAACTCTCATTTTAGTTCTTTCTTTAAGTTTGGGTTCCATTGCATTCTTGTGTTTGGTCATTGCAATCTCCAGTTTCT
GGGT
chr4_22034718 C Y Y Intergenic
ATATGCTACTAGCAACTGTCAAACTGATACTGGGGTGCTTCACAGATCTTGGAGGAATGTACTTGGCTTATTTGTGTGTATATATAGTACCCGCATGCCA
TGTTTTAAGAAGCTACTTACTGTCAAATAATTGTAGTTTATTGTTATCTAATTAGGCATTGCAAAAGATAGGAAATTGATTGTTAGAGACTGATAGATAG
GGTTATTAAACAAGAATTTGAATAAAGAAGGTGATACCAGTGAGTTTATTTATGAACTTGCCTTAATAGCAGCTTGCTATCAATGCATTTTATTCCTTA[
C/T]GGTGTCAGTAGCGCCCTCCATGATGGTCTAGTCATGAAAGTCGTCGTCTTCTCCATGCTTTATTTCCATAAAGACTCGTAGCATTCCACAACTCAA
GTTAGGGAGAGGCTTGTAGAGCTGCATATACTTCCAAGCTCTAGGGTGGGCCTGGGTGGCACATGAACAACATTGGTTGCTATAAAATTCCTACATGGGT
GGATTGACCTATAACTAGATACTAAAGCCTTGTTTGGGTTAGCTTCCTATTTTTTGTTTTAGCTGGAAGATGAAGTTAAGAGTCAAAGTAACAATTTTTA
AAAG
chr4_23534544 A R R GSVIVG01026448001 RNA polymerase I specific transcription initiation factor RRN3 protein
TGTCTAGTTAGGTCAAAGATTTTCGTCTTTTCTTTTTGCCTAGCTCTTGGGTGTTGTTTGTATACTTCGTGTGTACTTTTTTCGCCACTTCTAGGCATTA
CTAGTACAAACTTTTATTTACCTATCAAAAAAAATAAAATAAAATAAAATAAGAGCCTCTTTAGGGGATTTGCCATGCAAATGATCTTCCTTGCACTGTT
AGAATAATTTATAATTTACATGTAGCAGCCAAGGCTTTTATTTTTTGTAAACTGATGTGGAGATCACTAGCCACACTTTGCAGGACTGGGAAAAACCAC[
A/G]GTTACATGACCCCTCCCCCTAGAGCTGCATAATGGGTAAGCCAGGCCTCAAACTTGAGACCTCTAATCTGGGAATGAGATCATCTATGAGTTGAGC
TGTCCATGGGGGCAATTTATGTAACTATGGCTTTGTTGGTTTGAAATTAACAATTAAAACAAATAATCTAAGCCAAGGGTCCATATAATTGTATTCTTAG
TTTCATGCCCTCTCCCTCTCAACTTGAATCACCTTTTTCGTGTTCCTTCTTTTGTTATAACTGGTATTTTGGATGCCTTTGAACTATGGATCATGACGTT
TTTG