Home >

Resource Information


교배실생 GBS

TanoRed X Ruby(seedless) 교배실생 150개체 GBS data를 이용하여 만든 Genetic map


Genetic Map viewer


Chr No


MarKer ID Ref. Tano
Red
Ruby
seedless
Genic
Intergenic
Descript Flanking Seq.
chr4_1529990 G G R GSVIVG01035471001
GTGATGTAATTCTTTTCAAGATCGGGGGTATTTGTGCTGTGTTTCTAGTGATCATTCAGTCCGGCCAGCATGCTCTACAGAATTTACCTTCGAAACAAGA
AATCCTTAAAGCTTCATTTGTCTTAGTGGTGTTTGCAATTTTCTTTAATGGGTGATTTTAGATTATGGGTTGTTTCTTCACAAATCAGTGAAGGTTAGTC
ACAGGAAATGTGGTGATTAATTGGGGAGGGAGTAATCCTCTCAATACATGCCAACTGAGAGACCCTGGCTCAGGTAGCTGCTAATTAAGCCTATGCTTT[
G/A]ACAGTCCCAAGCATCTGTAACTTGAGCACGAGAATGAGCTCTTTGGACTTGATTTTGAGCCCATTTGACAGTGTCTGCTAAAAATGCTAGCAGCAT
AAAAAGCACATCTAGAAAAAAATAAAGTGATCAACACAATTTAGAAAGCACTTCTAAAAAATTGAAAAATCACTTGTAGAGTTTATGGAGAAGCACTTGA
ATAGAAACACATAACTTCAAATAGAAACATTGTCAAACACACTCTTCATTTCCTTTTTACTAGAGCTGTACGTATGAAAGGACCTTTTATGGCAGCGGGT
GGAC
chr4_1529991 A R A GSVIVG01035471001
TGATGTAATTCTTTTCAAGATCGGGGGTATTTGTGCTGTGTTTCTAGTGATCATTCAGTCCGGCCAGCATGCTCTACAGAATTTACCTTCGAAACAAGAA
ATCCTTAAAGCTTCATTTGTCTTAGTGGTGTTTGCAATTTTCTTTAATGGGTGATTTTAGATTATGGGTTGTTTCTTCACAAATCAGTGAAGGTTAGTCA
CAGGAAATGTGGTGATTAATTGGGGAGGGAGTAATCCTCTCAATACATGCCAACTGAGAGACCCTGGCTCAGGTAGCTGCTAATTAAGCCTATGCTTTG[
A/G]CAGTCCCAAGCATCTGTAACTTGAGCACGAGAATGAGCTCTTTGGACTTGATTTTGAGCCCATTTGACAGTGTCTGCTAAAAATGCTAGCAGCATA
AAAAGCACATCTAGAAAAAAATAAAGTGATCAACACAATTTAGAAAGCACTTCTAAAAAATTGAAAAATCACTTGTAGAGTTTATGGAGAAGCACTTGAA
TAGAAACACATAACTTCAAATAGAAACATTGTCAAACACACTCTTCATTTCCTTTTTACTAGAGCTGTACGTATGAAAGGACCTTTTATGGCAGCGGGTG
GACA
chr4_2013337 C G S GSVIVG01035525001 H(+)-ATPase 5
ATGTATCGAATGGCAAATTTCAGAAAGTCAAGTGGAACATAGGTAACAACGCTGTACAGCCAGATGACTCCAGCCCAACCCCAGCCGGTTCCCTTAATCC
TTGCGAAACCCCAGTTGGCATACACGGATATCACAGTTGCAACCTGTCAATTACAAGATGGTTAACCATGTTTAATAAAGCAAGTTAAATATCTATTTTC
TGAATCAGATACTATGGAAGCTCCAAAAACAAGCATCATGATGACAACTACAGCACATTAGGTACGTTCTTACCAGCTGAGCTGCAATGAAAGCACCGA[
C/G]TAAGAGAAGCCCAGGGCGTTCAACATAGGACCAGCTTCGAGACCTTGTCACGAAAATGAGGGCCTGACTCACAATACTCACTTGTAGGTATAAGGC
TGCCATCATTTCATGTTCGCTATATCTTATTGATTTTACACCAAACTTTTCCTGAATAGGAATAAACAATATGAATGAACAAAAATATTTGAAGCTACTG
TCTCTAAAATTATAAGTTTAAAAATAAATAAAACATTTCTTACCGGAAAGAAGTCGGTATCTTTCATGACCCAGAAGAATACAACAGTCATTAGGGCCAA
GTAA
chr4_4181406 G R G GSVIVG01035772001
TTGAGCTAGGTGCCAAACCTGCACTAGCTTTTTCACCTGGTCCAACCAGTCAACCATCAAGGAGCCCAAAGAGTAGGCATGACTTGCCACTTCCATCACT
GGGGGCTTGCATGACACTAGATTGCATGGATTGTTTGATAATGTCCCCGCCTCATAGTGACCGACCTTTACTGAGGGCTTGGTGGTTGTTGAGTGAGCTT
AGGTGGCCATGCTCACTCAAGCAGCTAGGGCTTTTATTCTCATGGTGTAGTCTTTCGGTCATCCTCCACACCTCCTCCACCTGCTTCTGGTACTCCATC[
G/A]ATTTAGTTTCCATGTCTCTTGCATTGTCGTGAGGTGCTCCTCCAAAGTAGGAGTGGGAATGTATTCATCTTCTATGGTGCTTGCAGCTAGGTGGTC
ACCATGTAACTTTCACGGCTTGTTGTCTGTTTCCCACATTCGGTGTGAACTGTTGGTGCATGGACTTCCAATGTGGGTTGGTAGATGGGTGAGTCCAACA
ACACCCTTGCCCTGCTGCCTGGTGATCGAATGAGTCGGCTTGTACTACTAGGACAAGCTTTTACAAACAAGGATAGTTGAGGGGTTTCCAACTATGCCCC
TTCG
chr4_4199905 C M M Intergenic
AAAGCAGCCTAACTTGAAATCAAAAAGCTAGAACAAGCACAGGTGGGTCATGTCATGCTGTTATGTGAAGTACAATATGGGTCACAAGAACCACAAAGTA
GTACAAGTCGGCTGATATTGAAGTACAGGCGGTGCATGTTAGCAGAAACCAACAAGAACACGCTAAAATGGACCAGACGATGTTTGGCAGCTTTGGCTCA
CCAAGAAAATTGAGCTACCACCTAGCAGACTAGTGGAACGAAAGGGAAAGTAGCAACAATATTGAAACAAATAAGTGGGTTATGATGCGCAGCAATAAG[
C/A]GGTGAACATGCTAAGATGCGCGGATAGAGGGTTGACTCACCATGAAACTTGATCAGTTTTAGTTGAGCTTCGAGAAGATGATGGGCTGGACCCAGA
TGGTGGAGGCGAGAGATTTAGGCAGCAACCAGCAGAGAAGGCCATTCTCTCTCTCTCTCTCTCCCCCAAATTTTGAGGAGAGGGTGATTACATATATAGA
GCAGGGGTGTTTGGGCAAATTTTCTCGGAAGTTGGCCAGCTCAAGGTGGGTGGGAAAGACGCCAACGATGGCCCTTAGTGTTCAAACACGTGGGTTGGAC
CCTC
chr4_4501570 G G S GSVIVG01035802001 Cytochrome bd ubiquinol oxidase, 14kDa subunit
GCAAGGATGGGCTTAGACTTGGAGTTTTAGAGCATAGATGTCATTTGTCAACACATACCCTGCTGGTTATGTAGACAATCACCAGAAGCACTTGTCATAT
ACAAGATGCCACAATTTGTAGTTACACATTGCACTTTTGATGTTGAATTGCTTGCTCATTTAGTTTAGCAAGCAGCATGCTTTTCTTAGCAATTTATTGT
GTGATGAAATATAGAATTGAACGTTTGAGGAAACTACTAATTAGAGCTCAGCTGCAATGCAGGCGGAAAGAAAAGAAATGCTTGGATCTTGTTTTTACC[
G/C]TTGTAAGTCATCATGAGTAATAGGCAGTGTCAAGTCAAAATAAAATCTCTTGCTGCTTTTGTTGTGCAGGTAAAGAGGGAGAATGCAGAACGTGAA
GCTTTGGGAGCGTTGCCCCTCTACCAGCGAACTCTTCCCTGAGCATCTGCCATCTACCGCAGCTATTCACCCATTTGAGTATTATCTTTAAATGAATTTA
AGGATAATGGTTTTTGGTTCCTGGAGGAAGTTGAAAGGGATTGTCCGACTGCTTCAAAAGTTTATTTTCCTTATTTAATTTCCGATATTGAATGGTTTTT
GGTA
chr4_4903979 G R R GSVIVG01035855001
TGTAACAGAGCAGAGGTTGTCTTGGATGCTGTAGTAAGCCCACAGAGATTATTGGTGTGTATGAGTCACCAAAGGGACTGACAATTCAAGGAAGAACAGC
AATGAGACCTAGCCCAGTAGAGGATTTCTGGAGCACTAGCACAGGTGAGATGGATAATAGTGCAGTTCAGTCCCAAGGAAGCATTTCATCTATCAGCACA
TCAAACCAAACCTTTGATCCCCACAGTAATGCGGGCAGCACAAGCAACCCTCCTGAATTTGTAAATCATGGCAAGTCCTTATCTGTTAACTTTTGCATC[
G/A]ATATATTACCAAGCCTCATGTTTGATTTCTATACTTACAACCATTGGACCATTATGGATGTGTCCCAAATTATGTGTTTTGCACACCATTTCAGCT
TTTCCTATTTAGGATGCTGCTGAGGGCTCCTATCAATATTATCTACATTTGTAGTTTGTGGGAGGACTCCTAGAGTACTGTAGCTAGGGCCATTTGATGG
TCATTTGATTGCAGCTGTTTCAAGATTCAGATTCCTACCAATCTTTTTGGATAAACCAGATGGTTCAGCTGTTCCCACTTCCATTTTGGTTGGTATACAG
AATT
chr4_5067251 G G R GSVIVG01035869001
GCCCTCTTCGAATTCAACCTCACCCTTCCCATCATGATGGCCCAGTTCCTCCTCCTCATGGTCGCACTCGACAAGATCTACTACTCTCCCCTCGGCAAAT
TCATGGACGAAAGAAACGCCGCTATCAAGGAAAAGCTCAACAGCGTGAAGGACACTTCCGGCGAAGTGAAGCAGCTGGAGGAGCAGGCTGCGGCTGTGAT
GAAGGCGGTGAGGGCGGAGATATCGGCGGCCCTCAACCAGATGAAGAAGGAGACGGCGGCGGAAGTAGAGATGAAGCTGGCGGAGGGGAGGAAGAAGGT[
G/A]GAAGCGGAGCTGCAAGAGGCTTTGGCCGTTTTGGAGAAGCAGAAGGAGGACACCATCAAGGCTCTTGATTCTCAGATCGCTGCTCTGAGTCAGCAA
ATTGTGAACAAGGTCCTTCCCCTCTGATCTTTTTTTTTTTTTTTTCCTTTTTCCAAATTTAATTTTCATGGCCATCATGGGAAACAAATTTAATTTCCTA
TTATAATGGATTTTGTGTAGCATATATATAATTGCAATGTAACCATCTACCCATGTGGAAATTTTTGGGGTCACTTCCAAATGAATGACAAATATGGGTT
GATG
chr4_5225959 T C Y GSVIVG01035882001 sucrose phosphate synthase 2F
ATTTTACTTTAATTGGCAGGCATTATGTCAATCACATAGCAGTACAGCATATTCATCTTTCATCTCAATGATAAAATGCATGACACGAGGGACAGATATG
TGTGCAGTGCAGAGAAATGTAATGAAATTCATGACCATATCCATACTTCACCCTTGGGTATAGAGGTGCAGCGGAAGGTGGGGATGAACTAAAAGGACTC
CATGGTACATCAGACAAAGGTGCACCAGTATGAGATGGGTTGACACTATCCAAATGTAAATTTCACAATTCACACAACAATGGCAACCAGGATATATAC[
T/C]TGTGCTTATGTGGTATTATTTATTGAAGTACAATCCTGTTCTCAGTATCACAAAGAATACCTTTGTTTTTGCTGCCAGATGGTAAATCTCAGGAAC
TTCAGACTGCTTGTGATGTTTAGGATAAGCCACTTGGCCATACATATCATATTTGTCAATCAGCTTAAGTATTGAAATAAGAACAGATGCATTTGTGCTA
GACATTTCATCGATGTCATCACGGTTGCCCATTATTAATGTCTGCAACAGTAGAAATTGCAAAATCACTGGCATAGAACCCCAAAGAAAAAATGAGCCGT
TTCA
chr4_7631202 C M C GSVIVG01036033001 Protein kinase superfamily protein
CATGGAGTAGAATTGAAACAACATGAAAAACATTAGGTGCACTACTTGTTTGTGCTAGAGAAACACTAGGAATACCCAACAGAGAATTGGATTTTAACAG
TTTCAGAAGGTGATTCATCTACTCCTTGCTGAAGGGACTTGACTCTGATTCATTGACAGCAGCATTGACCTTGGGATTTGAACGATTGCTTCTCTCTCCG
GGCTTGCTGCTCTGCCAATTTGCTGGTGTTCCATGGATTTTCCAGCAAGTTTCTCAAGTGTGGCGCAGTTTGTTACAATAATCGCATCAGACCCGTGGC[
C/A]TTTCTCCAAGCCCTTGCTGAAAACTGGCTGCTTTATTGGCAAAACCTTCAACAACATTGAGAGCAGAACTTTCAACAGTTCCACTATTAGATTTCT
TTCCCAACATTACGTGTCAACGACTTTTTGCCCTTTGAACTTCAGCAAAGACTTCGCTGATTTTAGGAAGAGGAACTCTGCCAATAATCCATCCTCTAAC
CTCATCAAACTCTACACTGAGTCCAACACGAAACTTATAAATCCTATGAGCCTCCATAGTTTGTTTGTAATGATTAGCATCATTAGTGGACTTTCATTCG
TAGT
chr4_8005927 A R A Intergenic
TGTGGGCTCCATGGTGGCTGTGTGAGTTGTGCGGGCTATGTGGTGGTTGTGTGAGCTATGTGGGCCGCATGGTGGCACAAATGGGAAGTGGTTGGTGAAG
ATTGGCAGCTTTGGGACTAAAGTCGGATGGTGTTTCAGTGGTGGAATGAGTGAAAGAAGTAGTGAGAGAGGTGGGTTTGGTAGGTATAGAAAATGAGGAT
ATGAATGGTGATGGGTATGGGAGGCATGAAGAGTGGCCATGAGTGCATAAATCCTATGGGCATGGGTAGGAAATGGGTAGTAGGGCAGCAGGTTGGGCA[
A/G]GTGTGAAGGAAGTAGGAGGTGAAAGTGTGGTGATGTGTTTGGTGGATGGGTTGAAGGTAATAGGTATGGAAATGAAGGTGGCCACACGCGTTAGAC
TCCATGTATGTAAGAAATAATGGAAATAAACTGAAGGTGGATTAGATGGTGTGGTTGGGGAGCATGTGGGTTGTGTGTGGTGGCTATGGGGTGGCTGTGG
GCTGCATGTGCTGGATATGATGGTCATGGGGTGGCTATGGGTTGCATGTAGTGGTCATAATCAGGATGATGGGGGATGATGGTGATGTAAATGGGGGAGT
AGTT
chr4_8598176 T K T GSVIVG01033155001 glutamate receptor 2.7
ATCATATGGTTATTTGTGGTGCTGATTCTTACTCAAAGTTACACAGCCAGCTTGACTTCAATGTTAACAGTTCAACAGTTCAACAGCTTAACCCAACTAT
CACTGATATAAATGAGCTCATAAAGAAGGGGGAGCGTGTAGGTTACCAATATGGCTCTTTCGTTTATGAATTCTTGATCAAGTCGATGAAATTTGATGAG
TCCAAGCTTGTAAAGTATGAGTCACCAGAAGAACTGGATGAATTATTTTCAAAAGGTGGAATTGCTGCTGCATTTGATGAAATCCCTTACATGAAGGTT[
T/G]TCCTTGCAAAATATTGCTCCAAATACACTGCAGTTGGACCAACATACAAGTTTGATGGGTTTGGATTTGTAAGTGTTCTCTCTTAAAGTGTACAAA
TTTTCATGCAGCGGTTTCTGATTTTTTATCATTTCAGGTCTTTCCAAAGGGTTCACCCCTTGTAGCGGATGTTTCAAGGAAAGTTTTAAGCGTGACCGAG
GGAGCTAAATTGTTAGAATTTGAGAAGGCATGGTTTGGGCAAACAACCAGTTGTCCAGAGCTCACCAGCTCAGTTTCTTCAAACAGTATCGGCCTTAATA
GCTT
chr4_9660945 C Y C GSVIVG01033203001 Transcription factor jumonji (jmjC) domain-containing protein
ATACAAAATAGTTGATAACTATATAAAATAAATTACAACTAATTGACAACTACACAATCAGTTGCACACAGCTGTACGCATGGCTATACATCACAGCTAT
ACATCATAGTTGTACCCACAACTGACTCTCCACCTCAAGTTGGTGCATAGATATTGCACATGCCCAACTTGGATAATGCTGCATACAATCGGCCATTAGT
AACTACATGAGTTATCATATTCACTAACTGATCTGCCCCTCTTAATGGGATTATCCCATTAGATGTATGCAACTTTTACCTGACATTAACAACAAGAGC[
C/T]GTCTCGTTAACAGAACCATAGGAAGGATTATGCGCTCAGAAGAGTCCAGTTGATAAAGCGGGGCCTGCTGCTGCTGCCATGGCAAGAAAGCGTATG
GGAAAGAAAGGACTGGACTGACAGGAGAGGGAGATTAAGAAGGTAAAACTGGAACGAATTATTTGACCTGATTGCTTTGTCTGTTTTCAAGGCCAGAGAG
ATTATAATTGTTCTAGACTCTTGAGGAGCGCTAGGAACTGTATATATCAAAGGTCAGGGGTGGCAAAAAGGACTTGTCTGGTTGAATCATTCAAGCCAAC
CTTA
chr4_10552054 G S G GSVIVG01035211001 Leucine-rich repeat receptor-like protein kinase family protein
CCACTAACTTGGTGAGGTTAGTCAGCGAAAGAGGCAGCTCACCAGAAAGAAAGTTGTGAGAAAGATCAAGGTGGGTGAGTTTTGTGAGAGTACCTATTTG
ATGTGGGATGTCACCATTCAGGCCAAGAGAGCTAAAATTTAGTCGAACCAGATTTGGAAATGAAGAGAAGTTAAATTGGGTAAGCAGCCCATTTTCTTGA
GTTGGAACCGCCCAAATCTCAGTGACACTTCCCCCCGCATTACAGCTTATGCCTGGCCAATTACAATGGCCTGTAGTAGTGTTGTAAGACCGCCACCAA[
G/C]TGCTCCTGCGCAGAGCCTCACCCTCAATCCATGTCTGTGATGATGCTGCTGCTGCCGCGGCCATTGCAACCACCCACATTACTATCACTGCAGAAA
TGGAGGAGGCCATGTTTAATCATGCAATTGTCTGTGCTCGAGACTGGGAATAAGGACTTAAAATATGGGCGAGGAGAGTCTTGAATCAAGCACACTGCCC
CTCAAGTCATTAGTCTTCGGGTATATTTCTCCGTCAATATTGCTGCAAGATTTTTGCCAAACTTCATCTTGTTTTCTTCGTCAAACATAGTAGGATTTGT
TTAT
chr4_11452728 G R A GSVIVG01035253001 SET domain group 40
TGCAGCAATGAGTTATCATTAGGGTTTTTTTATTCTTTGTCCTTTTTGATAATTTTCTTGAGCTTCTAATTGTTTTTAGTTTCTTGGACTATAAACAAAA
TGCTCAAAATAACACAAGAAAGTCATAAATAATGAAACCGATCATCCAAAGGGCAACAGGAAGCTATCATACTACATAATATTTGCTTTCAGGAAATCAA
GAAAGTTAGCAATACCTGCTCTCCTTTTTTATAATTTTTCCTAGCATAGAAGCAATATGCAGCAAGATCTTCCTTGTAGCCCCCATCTGTTAACCTCTG[
G/A]GAGAGAACATCATCTTGCTCTGCATCTGAATTGCTAGTAGCATCCTTATTCCAGAAAGAACTATCTTGCAAGGAAGATTCATTTCTTGAACCCTTC
AAATCTTCCCAGCCACATGGTTCTTCTCCAGGGGCAGCATAATTGTAGAAGTCCCCAACAGGGCATAAACATCCAGCGTCATCCCATGGTATATGCATCG
TGCGTGAGGATACCTTCAAGCATATTGAAGTCCAAATGTTTTTACTATTGCCAGTAAGAAACAGCATAAAAAGAGAGAAACACAAGTGTAGAATGGTACA
TTGT
chr4_12174593 T Y T GSVIVG01001480001 Haem oxygenase-like, multi-helical
AGAAGTGGATTGACAACTATTCTTCTGAAGGTTTCCAGGTTTGTACTTAGCAGTGAGCATTTTTATTTTATTTTAAAATTGTCTAACTGTAAATCTCTGC
TGACGCCATTCTGAGAGAAGTATACTTTACATAAATGGTTTTCTCACTCAGGCAGCTTAACTAACTTGTTCTTTGAATTTAGGGTTCAGCTTTACAAACT
GAGGACTTGCTGGATAAACTAAGTGTCTCTTTGACAGGCGAAGAGCTTGACATCATAGAAAAGCTTTATTACCAAGCTATGAAACTTGAAATAGAGTTC[
T/C]TCTGTGCTCAGCTGCTTGATCAGTACACTATAGTTCCTCTAACTAAAGGGCATGACCCTGCAGCAGATCGTCTTGTGATATTTTCTGATTTTGATT
TGACATGTACAGTTGTTGACTCTTCTGCCATTTTGGCAGAGATTGCAATAATAACAGCACCAAAATTTGATCAGAATCAACCTGAAAATCAAATTATTCG
GATGTCCTCAGCTGACTTGAGGAACACATGGGGTGTTCTATCCAAGCAGTATACTGAAGAGTATGAGCAATGTATAGAAAACATTCTGCCATCTGAGAAA
GGTA
chr4_13019589 A W A Intergenic
GCTAAAGAGCTAGAGTCTATTTAATTGACAAAACAAAATTTCTAAATTGGTGGATTCATCCTCCCCCAAAGGCATAAAGAGGAAAGTCTTATCCAGAAAC
CATGGAATCCGCCCCTCTTAACTAACTTTCAGAAATGGGAAAATCATCGAAAAGCAGCCAGAGAAAAGCTTATCAACTATTTGCGAGAAAAGTCATGGAG
GTTTCCTCCGAGAGAACCTCAAACTGCTGACTATTTGATTTGTTGGACTTTGACTATGACGATTCAGGCGAACAATGGGGAAAAGAGCACATGGTTATG[
A/T]CAGTGAATAGAGATGCATGTGAGTGGGCGGTGGGCGCTGCATGTGATCACGTTGGCCTATATTCATGAAATGTTGCTTTCATCCAGTGCTACGCCT
GCCAGCACTGCCACATGCTGCTAATTCCTTCTGGTTTTTCTTGAGCTGGATTTTATAATTCCATCGCTCCATGTTAAAACTAAAATATTTTAAATCACAA
TACGTTTCCACCATTTGAATGCCTTCCGTAGTACAAATGTGTTGGACAGTATAGTTGGAGTAATGTGTATGAAAGAGAAATACACAATACCACTTTCCCT
TTAA
chr4_13217297 A R A GSVIVG01026304001 polyamine oxidase 4
TCAGCTGGAATTATGGCTGCTGAAAACTGTCAAAGGTATATCTTGGAGAGACGGGGAAACTTGGAAAAGCTCCAGCTTGTCTCTCTTAGGAGTGCAATTC
ATGAGGCTGCAGTCCCCCTCCAGATATCAAGGATGTGAAACATATACATTCAGCAACTTGAAAAAAAAGAAAAAAAAGAACAGGTGCTATCCTTTAATTC
AGTGTTTTTAACTTGTATGCTCCGCTGATACTGTGGAAAACCTTTCTTTCATTCCTTGGCTGCACAATCCAGCAGTGTGAAATTCCGAGTTTCAAAGAG[
A/G]TGCTCCTATTCTTATTTAACTTTGTGGTTGGCACAGCTTTCGCTCGTTTTTTATGTTCCTTTATTTGCTGCAATTTACGTTTCTATTTAGTATTTA
CATGGAATTACAATCTTTAAGAGCCTATGGTGAAATATAAATTCCAAAGTGAAACTGCATCTCTATCCTTCTTCCCCTTTGAATACCCTACTTGACCAAC
ATAAAGTTAGAAGAAAAAAATAAATATATAAAGAGGAAAAATAGAAGGAAAGAGATCCATGGAAAAGTTGGAGTGAGATGTACTTGAAATCTTCCTCTGT
TTTT
chr4_15481952 G G K GSVIVG01026388001 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
CATAACAATATCCTTCTACAATGAGAAAGAGACATGCATTATTAGACCCAACAGAGTACGTAATTATATTACTAGTCTTCCTCCAGCGCCAAACCAGGCT
CCTGCAGTACGAGTTGAGCCTTTTCCTGAATGAGCTTCCATAGACTATCAACATGCCTAATCTCAGTCAATGTGGACCCAATTGCACAGCGTATGATATA
AATCCCACCCACCACTGCATGAGTCATGAATGCAGCACCACTTCCATTGACAGCCATTAGCAGCCTTGAGTTCAGTTCTGTGCCCTCCCCTTCTTCTCT[
G/T]GGCCTCAGTCTGAAGCACACCAGTGCAAACCTTCTCGGCACCACAACCTCAAATCTGGGATCTGTGGCTACATGTGCCTCGAATCGCTTGGCCAAG
TTTACATCGCTGCGTATATGGAACATGAGGTTGTCCAAGCCATGCCTTCGAATCACCACCCAAACTTTGATGGCCCTGAATCTTCTACTTAGTGCTATTT
GCCAATCTTTGTAGTCTATGACCTTCTTTGATTCGCTTGCATTGTTCCTCAGAAACTCAGGAGCAGTTGATAATGAATCCACAAATAGCTTTGGTTCTTT
AATC
chr4_15703114 A G R GSVIVG01026406001 Protein kinase superfamily protein
TATCAGTTGTCTGAATAATTTCAGGTATGGTTTCAATTTCTGAGAAATTCATACAAGATTTTTACCTAGCCAGAATCATAGTTGGTAATTTTTTTCCCTC
TTGATGACCAGCCTGAAATTTGAGTCTACTCTTGATTTTGCAGCTATGGAAGGAGGAATATACGTGGAAGATTACCTATCCAGAATGATCCAGGTTGCTC
CTAGTTCTCCGGCTTTTGTAGCAACCGCCCCCATCTCTGCATCAGCTAGAACTTCAGCTGCAGTTTGGACCTGTCATCCGATGATTGATCATATAACCC[
A/G]ACAACAATTGTTACAAAACAACACTGTGAGAAGGAAACACCCCCTGTACCTGCTTGACATTGTGGGCTAAACACAGTTGCTGCATCATCTGAACAC
AGACACCGTTGATTCGATTGGATGCATCATCCTGAGCTCTATTAACAAGGCCCGCCTGATCAGATGTTGAACTCTCCTCCTGCCTAAGACCCAGTTTCTT
TAGCAGACCTGAAGCAACAAAAAGAATCAAAACATGGAAGACATGGCTAACAAAACTGTCCAAACCAAGCAGAAAGGAGAAATGGAAACCTACAAGAAAG
AAAC
chr4_17487857 T C Y GSVIVG01019038001 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein
TTACAGAAATTCAGATATCGACCTCCCCATAAGGAGATTGCCAGAAAAAAACTCTAACTGGAATTTTGGTATCCTGAGACATTATTAGACAATTCCCAGG
CCACTGAAGTGGTCAAGGTTCTTGACAGGGCTTGCACTATCTCAACCATATCTGGGCGACTTGCTGGAGATTTCTTTAAGCAGCTATCTATCAATCTGAT
CATAACAATGGCAAGTTCCAAAGGATAATTCCCACTCAGGGAAGGATCAATGAAGTTCCTCAACTTCTCCTTTCCATCTCCCTCATGGAGCACAGCAAC[
T/C]AAGACATCTGGTAGGTGCATGTTCTCACCTTCATATAATGCAGCAACTTCTTTCCCTGTAAGCATCTCCAGCATGAGAACCCCAAATGCATAAACA
TCAAGCTTTGTGGAGACCAAACCATTCTCCAGATACTCTGGTGCCATGTAACCTCTTGTCCCAATGATATGCCTGGTTAAGGCAAACTGACCCTCCTGCC
CCTCTGCTGACCTTGCTAAACCGAAGTTAGCAATCTTAGCCCTGAAGTCACTATCAAGAAGCACATTACCGCTTTTTATGTCCTTGTGGACATAGGGAGG
GCTG
chr4_17568372 T T Y GSVIVG01019031001 GNS1/SUR4 membrane protein family
GCCGTCTACAGCCTCTCCATGGCCTTGATTTCAGCCGTCATCTTCACCGGGACCCTTTTCTCCGCCGCCGCCGAGATCCGGGACACCCGGTGGTTCTGGC
GGAGGTCCAAGACCCCATTACAATGGCTGCTGTGCTTCCCTCTGGGGACACGGCCATCGGGGCGGGCCTTCTTCTGGTCATACGCCTACTACCTCTCTCG
CTTCCTCCACATGTTCCGCACGTACTTCACCATATTAGAACATCGTAAGCTGGGTTTACTCAACATTTTCAATAACTTAATGCTGCTATGCATGTCGTT[
T/C]CTGTGGCTTGAATTCTCACAGTCATTCCAATTAGTGGAAATCATGTTGGCCACCCTGGTGTACTCTGTTGTATACGGCTACAAGTTCTGGACGGCA
ATCGGGCTGCCCAGTACATGCTTCCCATTTGTGTTGAGCTGCCAGATGGTTTTACTGGGCTCTAATGTCCTCTGCCATGTGGGGGTCCTTTTACTTCACT
TGAGGAAAGGTGGCTGTAATGGAATTGGGGCCTGGATCTTCAATTCTGTGCTTAATGCTGCAATTTTGCTTCTTTTTGTTAACTCCTTTGTCAGGAAGAT
GCAT
chr4_18065690 A G R GSVIVG01018985001 plant-specific TFIIB-related protein
TTCGAGTCCACCGGCTTCATCTCCGCCTTCTCCACCTGGTCCCTCGACCCATGCCCAATCTTCGCCCGCTCGTGCCTTTCCTTCTCAGGCCACCTTGCTG
AACTCGAGCGTGTTCTCGAATCATCATCATCGTCATCATCGTCATCTTCTTCTTCTGCTGCTGCGGCAGCGTCGTCTTCGTCTCTGGCCTCCTCTGGACC
TGCGGTTGTGGTCGATAATCTTAGGGCTTATCTGCAGATCATAGACGTGGCCTCCATTTTGGGGTTGGACTATGATATAGCGGACCACGCATTTGAGCT[
A/G]TTCAGGGACTGTTCTTCGGCTACCTGTTTGAGGAATCGCAGTGTGGAGGCTCTTGCCACTGCTGCTCTTGTTCAGGCCATTAGGGAGGCCCAGGAG
CCCAGAACTCTTCAGGTCTGTCTCTTTTTTCATTTCGTTTTATTATTATTATTATTATTTTTGGGTGCTTATCAAGCAATCTAAGACTGGATAAGTTAGG
GTTTTGATTTTGTGTTGCTATTTTTCTTGTTGAATTCATCATAATGCTTTAAATTTCTTTGTTTCCTTAATTTATTTTACTTTGATTTCTGTGATATGGA
GTTG
chr4_19255694 G G S GSVIVG01018851001 RTE1-homolog
CAATAACTGTTTCAAAAATGAAATTAGGCACACGTACCTTTTCTTTGCTAATTTGGATATAACGGGTCACTGCTCCAAAGGCAAAATTATCTACACAGAC
AAAATTGGGCCCTGCAAAGTCCAAGATTACCCCATCCTCTCTGCATATGCCAATGTGGCCAACGAAAGGAATCAGCCATGATATGACAGGAAGAGGGGTC
CACACAATGCAGCATGGAAACCGAGCTCGTCTTGGGTCAATTTGCATCATTTGTGAAACACTTCTTTCGATCATCATATGATCCTCAGGATCTGCATTA[
G/C]AGTCCATGGCCAAAGCTGCACAATGATGACCTGTCTCAAACTCTCAATAAATGAGCCCTCATGAAAGCAAATGCAGTTTATCCCTTGATATATTCC
GTTGTCAATGATCATTTGTCATATAATATTTAAACCAAAAATGTTAAGCATCACAGGGCATAAAATTTAACCTATGCTAATAGTCCGAATGACTCGTGTT
TCCTCAAAACCATATCTACTGAAGCACATTTTGCACATGTAAGGATGTTTGCTTAACATGTCACAAGAAATCTGCCCATATACAGTAGTCCTTATCCATG
GAAT
chr4_19774600 A M M GSVIVG01018797001 Plant protein of unknown function (DUF869)
AACCTAGAAAGTGAGAACGAACCACGTGTCTCCATGTTCTAGGCGGACGGACGCTCCCTATGCCATAAGTAGTTTTCAAAAGGCAGCTCCTTTTCTGGGA
CCCGCTGGCGCGTACAACCTCTCACTATCGCCCCTAGCCTGCGCTCCCCATTTCCCACCATTTGAAAAGCCTGCTGACCCTGATGGGGACGTTGGCTTTG
TGGCTCCACCAGGCGCAACGCCGCAGCCACCCACAAAATTTGAAAACAAAAGGAAAATGAATGTTTGTTAAATCATATGCCGAGGCCACTGTAAAAACT[
A/C]AAAAAGTCAAGGCTTAGAGCGTCTTCCTTTTTACTCCTCACTAGTAGCATCTGCCATGGTGCGATATGCTGCATTCAGTGCCGGCATCCAATTCAA
AAAATCCCGTTATTAGCGAGCCTAAATTCCGGGTCCAGCCGGAATTTAGTTATAAATCTCATGGATTTCTCCTTTGAGCATGTGCATGGATTTACGGTAG
AAGGGTCCACAGACTCCAAACCCACCCATTCATAACAACTGAATTCACTAAAAAACAGTAGCAGCACGTGCTCGCACCTGGGCCCTGCAAAACGCGGGCC
ACGT
chr4_21141468 G G S GSVIVG01026605001 nodulin MtN21 /EamA-like transporter family protein
AGACATGGCCGCCTCCCACCATCGTTGAAATTAGTGAACTCACCATGACCAAAGCAACATGCCCATGACTTTTCTCCACTTGCGTGTATGAGGTTCCCGT
AATCGAATTGGTAATCCAAGACCATACATGGTGGTTGTAGACATGATTTGGGCTTGGACTTAGAGGAAACTTTTCGCCAGCCAAGCTGCCTTTTTAAGAG
TTTGTCCTTTTAAGAGTTTTGCCTACGATAGACCGCAATACGCCTGCAAGGACGTCAGCAAAAGGACCCCCACACATCACTTTGGAAAGCATGATCTAA[
G/C]TGTGGATTCTGGATTGCTCTATCTGACATGATTCCAACAGCCGGCAGCTCCACTATTATGAGGGCGCCTCTCTCAGAAATCCCTTTTTGTCTATAA
ATACTCATATGGTTTGAACCAGAGAGTATCCAAACAGCCTCCCCAACAGCTTCATTTGCTTCATATATAGTCATTGGCTTGAGCTATAAACAGCTTTTCA
GTTGGTATATTACATGGCTAGTGGGAAGTTTTGGAATGTCATGACAGGGCTGAAGCCAGTCCTGGCAATGGTGGTGGTTCAAGTGTCACTGGGAGGAATT
AATA
chr4_22484654 A G R GSVIVG01026504001 RNA-binding (RRM/RBD/RNP motifs) family protein
TTCAAAAAATTGTTTTTTGGAAACTATTTTTGAAAACATTCCCAAATATGCCAGAAATTATGCAAAACATAAACATATGTGGAGATAAACATTTGTGAAA
TAAAGAATTTAATCCCAAAAAAAAAAAGGGAAATTAAATTCATCATCTTGAAAACACCAAAATTTGATGTATTCTTGGATTTTCTTTTAGATACAATCAA
GATGGGTGGTGGGAGGATATTTTTTTGGCTCCCTTTAGCTGCCCTTGCATTAGAATTACCTGAATTGCAGCAGTTGTGGTCCTTTCCAGAATAATGCCA[
A/G]TAGAATTGTGGTCTTTTACAAACCTGAGCCCGTAAACAACTTAGTAGTTTGAGCTTTGATTGTCTATATGGAAATTTCTTCTCTAATCAGCAGCCA
AGTTAGGCAATTCTGTAGTATCTGCTATAATTAAAATGGGAACCACACTAAGGTTCAAGCTAGACAGTGGTTGGCTATTCTAAATTTTTGTGTATCTTTA
GGGATTTTTGGAACACAATCAATCTTTTTTCCTTGTAAATTTTTTTGCAGATCACCAAGGGGCCATCGATCCAGGAGTCCCAGGAGGAGATACTAATGTT
GATG
chr4_23285264 C Y Y GSVIVG01026456001 Copine (Calcium-dependent phospholipid-binding protein) family
ATTCAATGTAGACGCAAATATTCTGGGTTTGTTGGAAGACTTGTCTGCTGAAAACAATTTCTTGGGTGCCTCTGGGAAAGAGAGGCACTTGGAGGTGGGA
TGTTTGGATTTGCAAAACTTTGGATCTGTTTAGATAATTAGACTGCTCTTTTTTGTTGAAGACCTCAATTGATTAATCAATTGGAAAAAGGCTTATCATA
AAAATTCATAGTTAATAAGTTCTCATAAATAAAAATATGTAAAACATCTGATTTGAGCATTCAAATGCTTGCAGCATGCCACAAGCCCTTCATTGGTGC[
C/T]CATATTTGTTTTCCTGTCTACTCATGTGAATCTCACATTGGGATGTCATTAGGATTCATAGATACAATCATGATGAGTTTTCTTACCCTTATACCC
ATGCACGCTTAACATCCAGGTCCAACTTCCTTTGCCCCGATAATCGATGCAGCTATTGACATTGTGGAGGGAAGCAACGGGCAATATCATGTTCTTGTCA
TTATTGCAGATGGGCAGGTTCATGAAACATGCTGAATTCCAGGACTTTCTTCTATTATTTACAATGGGTTTCAATCAACCTCTTAATTTCCCATTCTTTC
CTTT
chr4_23597803 G R G GSVIVG01026444001 hydroxy methylglutaryl CoA reductase 1
TCTTAAACCCTCGGATGCACTGCCACTGCCTCTCTACCTTACAAATGGGATATTCTTCGCCTTGTTTTTCTCCGTGGCCTACTTCCTCCTCCACCGTTGG
AGGGAGAAGATCCGTACGTCAACTCCTCTGCATGTTCTCACCCTCTCTGAAATCGCTGCCATCGTTTCCATGCTGGCGTCTGTTATCTATCTGTTGGGTT
TCTTTGGCGTGGACTTCGTCCAATCTTTGGTCACCCGGCCTTCGGGTGATGTTTGGGACGCGGAAGACGAGCCCCACGGCGCCATCCTCGAGGAAGACA[
G/A]TCGACCCGGGCCTTGCGCGGCAGCCATTGATTGTTGTCCGCCTCCGAAGGTGGCCGATGTTGCTCCTGTGACGGTTTTTTCGTCAGAGGAGGAAGA
GGAGATGATCAGATCGGTGGTGGCGGGGTCTGTTCCATCCTACTTGCTCGAGTCAAAACTGGGTGATTGTAAGAGAGCGGCAGCGATCAGAAGGGAGGCC
TTGCAGAGGACCACAGGGAGGTCTCTGGCGGGGCTGCCCTTGGATGGGTTCGACTACGAGGCGATACTGGGGCAGTGTTGCGAGATGCCGGTTGGGTACG
TGCA