Home >

Resource Information


교배실생 GBS

TanoRed X Ruby(seedless) 교배실생 150개체 GBS data를 이용하여 만든 Genetic map


Genetic Map viewer


Chr No


MarKer ID Ref. Tano
Red
Ruby
seedless
Genic
Intergenic
Descript Flanking Seq.
chr4_511661 C S C GSVIVG01035328001
ATCCTATTGGATGCATGCCACAATGATATTAAATTACATGTTCCTCAAAACCCTCATTGATTAATAGTATCCCATCCTCTTATGTGGTCCAACTTTGAGA
ACAAAAAGAAAACAGAGAGTTCAATTAACCCAACCATAAGCTTACCTATGACACCACCACCAGCAGTTGAACCATCTAAAGTGTCATTTCCACTACCACT
ACCACTACCAAGTTCGCAAGGCAGATCAGCATTTCCATATGAAATACCACCCTCAACACAGCTGCCTTTGTAACACCCATCCCCACCCTTACCACCATG[
C/G]CCACCACCACTGCCAAGACCAGAACTTAAAAATTTTCCTCTACCCACACCACCGGTGCAGCCTGTAGAAACACCAAAATCATGTATGAGAACTCAT
CCTAGATGTGCCCTAAATTTTGAGGGAGGAGGGGAGAAATAGGAGAGAGAGAAACCATACCCATCCTAGATGTGCTTATTTTACCAGAAGATTGGACAGC
TATAGTTCTTGCCCTGTGGAAATGGACAACGGACCCTTTTATAAGGCCTTGAACAGTAATATCTTCAACTCGACAGATCTGAATAAGAAAAATTAAGAAG
ACCA
chr4_1529990 G G R GSVIVG01035471001
GTGATGTAATTCTTTTCAAGATCGGGGGTATTTGTGCTGTGTTTCTAGTGATCATTCAGTCCGGCCAGCATGCTCTACAGAATTTACCTTCGAAACAAGA
AATCCTTAAAGCTTCATTTGTCTTAGTGGTGTTTGCAATTTTCTTTAATGGGTGATTTTAGATTATGGGTTGTTTCTTCACAAATCAGTGAAGGTTAGTC
ACAGGAAATGTGGTGATTAATTGGGGAGGGAGTAATCCTCTCAATACATGCCAACTGAGAGACCCTGGCTCAGGTAGCTGCTAATTAAGCCTATGCTTT[
G/A]ACAGTCCCAAGCATCTGTAACTTGAGCACGAGAATGAGCTCTTTGGACTTGATTTTGAGCCCATTTGACAGTGTCTGCTAAAAATGCTAGCAGCAT
AAAAAGCACATCTAGAAAAAAATAAAGTGATCAACACAATTTAGAAAGCACTTCTAAAAAATTGAAAAATCACTTGTAGAGTTTATGGAGAAGCACTTGA
ATAGAAACACATAACTTCAAATAGAAACATTGTCAAACACACTCTTCATTTCCTTTTTACTAGAGCTGTACGTATGAAAGGACCTTTTATGGCAGCGGGT
GGAC
chr4_2009468 C Y C GSVIVG01035523001
ATCCTTGATCTGAGACAACCCCTCTTTCATGGCCTCCAGCTTTGAGACATGTAAAAGTAGTCCCTTCTCAGCAGTTCTTAAACACTTGAGGAGGTGGTTG
AACATCACCAGAACTTCTCCCCATTTACGAGAAGGGGATTCGGGTGCTCTTGCAGGCGCAGGCCGCATCCATGAAGTAGAGTCAGGATCATAGGAAATGG
CCTTATCAGCTAAGAAATTCAGGCAGCTCAGGACTATTTGCTGCCCCATCATCATCCCTTTGCCTGGAGGATGACGTTGATGATCCAGAGACTCCATCT[
C/T]GGATTTCAATCCATTCAGTATCTCCTCCAGCGCACCCACCCATATCCGATGCTGTGTGACTTGTGAGCATACTGTGAAACGTACTTCCTTCCTTTG
CTGAGCAGAAATGTTCAAGAAGTTGCAGACTTTAGTCAGTGAATTCACAGTCATGGGCTCCCTTTCATTCGGTTTACCGAAACAATCAGGCAATGTGCAT
TGCCCAGCTGCCAGTGATGCCATATTCTTCTTCACTGCTTGCTGCATCAATGGAGACCCAAGAAAAGCTCGAGCGAGCGACTTGAAAGTCTGCATTCTTT
GTTC
chr4_2538543 T A W GSVIVG01035587001 DDB1-CUL4 associated factor 1
TTCCCGATGTCTGGCTGCCTGAATCTCGGATTAGTTCTGATAGCTTTTTCCCAACCTAATGCAAAAAAAAATAGAAAAATATAGTAAACAATAATAACAA
CAATAATAATAAATATTCATAACAATAAAATCATATACAGAGTATAAACTAAAGCAAATAAGGTAAGGAAAACTGAAGAGGCTCTCAAGAATTTTGAATG
AAATATACAGCAGGTCAACCCAGAATGGAAAGAATTCCAATACATCTTAACCTTCTACAGGAATGCAGCATCTTCCAAATAAATCCTCGCAAACCATAA[
T/A]ATACCTCTAGTTTGAATAGGCCCACACTAATTTCATGTATAAGTACAAAAGAATTCACTTCAAGCACAGAAGTTCAGGTTTTCTGGCAGCAATATG
TTCAGTTTTGCATCACTGTTCACTCCCCTTTCTTGATAGGTGAGCAAAGGGTATTACTAGGCACAGAGGAAAAGGTGGGGTGAGGGGTGGGGTGGGGTGA
ACATTAATGAAAATTGAACATCTTGATCCTCAAAAACCTGAACTGTTAATCCGTAAATTTCTGTGTATTCTTATAACAATGTTTTAGACCTAGACGCATT
AACA
chr4_3007303 T Y T GSVIVG01035651001 embryonic flower 1 (EMF1)
AACGAAACATATAATAGGGATGAAAAAAATAATTTCCTATGTCTATCAGAGATTCAGAAGTAAACTCCTTTAATGTATTTAGTCATGGAGTGTTGCATGA
AAATGGAACATATATAAACCATTGATAGGGTGCTGGTAGCAGTCAAAGAGGCCACTGCTCCAGGGGTTGCCAACAGCCTGAATAAGAATCAGATGTATCT
GTCCAGACTCCTGCCTTGTCACGGGCACGAGAGCATTAGCACCGCCACCTCCAGCGCTACCCTCCATCTTGTTAGCCTCTGGCAGCGGGGCGGCATACA[
T/C]CACAAGCTGGTCGTTTGGACGCGGCGGCTCAACCACTTGCATTCTAGGCTGGGGCGGGAACGCTACTGCTGGGATTGAGTCTATCCCATTCTCCAA
CTGTGGCTGCTGCTTCCTCACGTTTGCAGTTTCTGGTGCCAACTGCACTGGCTGGTTGCTTGAGGGTGGCGCGTGGCTGTCACTGGTCTGCGGTGGGAAG
GTCACAGCAGGGGTTTTGTCTGTGTTCACCGTCAGGTGGAGGTGTCACGTGAGGCACGTGATGATCATTCGTGTGAGGCTCGGCCGTGGGGTGTTGTGGG
GGTT
chr4_4501570 G G S GSVIVG01035802001 Cytochrome bd ubiquinol oxidase, 14kDa subunit
GCAAGGATGGGCTTAGACTTGGAGTTTTAGAGCATAGATGTCATTTGTCAACACATACCCTGCTGGTTATGTAGACAATCACCAGAAGCACTTGTCATAT
ACAAGATGCCACAATTTGTAGTTACACATTGCACTTTTGATGTTGAATTGCTTGCTCATTTAGTTTAGCAAGCAGCATGCTTTTCTTAGCAATTTATTGT
GTGATGAAATATAGAATTGAACGTTTGAGGAAACTACTAATTAGAGCTCAGCTGCAATGCAGGCGGAAAGAAAAGAAATGCTTGGATCTTGTTTTTACC[
G/C]TTGTAAGTCATCATGAGTAATAGGCAGTGTCAAGTCAAAATAAAATCTCTTGCTGCTTTTGTTGTGCAGGTAAAGAGGGAGAATGCAGAACGTGAA
GCTTTGGGAGCGTTGCCCCTCTACCAGCGAACTCTTCCCTGAGCATCTGCCATCTACCGCAGCTATTCACCCATTTGAGTATTATCTTTAAATGAATTTA
AGGATAATGGTTTTTGGTTCCTGGAGGAAGTTGAAAGGGATTGTCCGACTGCTTCAAAAGTTTATTTTCCTTATTTAATTTCCGATATTGAATGGTTTTT
GGTA
chr4_4833363 A R R GSVIVG01035846001 carboxyesterase 17
CAATATTTTTATCGATTTTTCATTGATAATTCGATATGTATCAATATTTTTATCAATTTTTTGAGAATTTAGCTGGTTAAAATTTCTTTCAAAATATACT
AGTTGTGTAATTAACATGACATCATCCATTCTGCTCCTCCCTAATCCATTCTGCTCAATTACATTAGTAGAAAATGAGTTTCACTTAGAAATTTTGAACA
GAATTACAACTTGGTATTTGCTGCAAAGCCCAAATCTATGCTGAGAGGATACATGCCTCATAGCTAACTAGAAGAGAAGCCGATGACTCGTGGATGGCC[
A/G]TATGAGAGGCTAAAAACTGTGTATGAACTCACTCATTTGCTTTTGCAGCAAGCGAGTGGCCTCATATTTTGGATGGAACATATGATACACATGCTG
CTCTCCTTAAGCTTCCACCAGCTAATTAATTTGAAGTGTCCTTAAATAGGGGTGTAACTTGGACAGACCAATGTTTGGACAAATTTAGGTAAACATTTTT
ATTACTTGAGTTGAGCTTGAGCTAAGTTTTTTCACGCAACCGATACCACATCCTCGGTTGCGTGATGGCCATCTAAGATGCTAGAAGCTGTGGATGAACT
CACT
chr4_6021519 C Y C GSVIVG01035926001 SPFH/Band 7/PHB domain-containing membrane-associated protein family
ATTCCGGTTTGTTCATGGACAGTACTAAACAACGGTGGTAGCATCTTGTAAACGCCGGAAATTTCCTTCATTGCGGTGCTGCCGCCACTCCCACCACCAT
CCAAGGCCTCCGCGCCACCACCTCCATTAGTCCAAACGGTAATTTTAGGCTGCAGACCTCGTACAGCCTCAGCATTAATCTTGGCAATCTCTTGAAATGT
TCCGCCACTCACCATCATATAATCCCTCAATGCAGCATAGTTTCCGCCCAGAGCATCAAGGAGTGTGCGTAGATATACGCCTTGGGCTTGCGCCAGCGC[
C/T]ACGATTCCTTCGGCTTCTTTCTTCTTCGCATACAATTCTCCATCTGCGAGTTGCTGGCGTGCGTAGAATGCTGCCTCTGCCGATGCCTTTTGGGCA
GCGGCTTCTTTCTCCTTCTCGTAGAGGACTGCTTCTGCTGCCTTCTGTTTTTTGTAGAGTTCCCAGTTTGCTTCTTGTACCTAAAGTTGTCAGCATTGAT
GAAAACATCAGTAATTAATCACATTTAAATTGGTATTTTAATTTTATCGATAATACATCGATAGTCTAGATCAAAACTTATGAAAATATTAAGAAAAACT
TTAA
chr4_6540279 T K T GSVIVG01035963001 nuclear RNA polymerase D2A
TCAATGAGTTGTTGTTTCTGATAAAAGAAAGCCATATTGTCAACTAGGAACTCAGCTTTAAAAACTATGATATGGAATCGTGTGGTTATCTTGGTGGTAG
TTGGTCTCTGGTGCACATAGAACTTCTACATAGAAATTTATAATAACATATGCAATGTTATGCTTTATGACTAAAGCTTATGTATTCAAATAGCGTTCTT
TTTCCAGCTTTCAATTGCTCATCCCTTGTATGTTAGTGCAATTGAATGCAGCAAAGTTGGACTTCATATATGCATGTAAACTGAACTTTAATCTTATTA[
T/G]TTTCTTGGTTTTGCACTTAATGTCCTGCCCTTCTGATGTAATGGCTCCATTGCTGTCTGTGGCATTTAATTTATGAACTCTTTAGAAAAGAGTTTT
ACAGCTGGAAATCTGCAGCTCAACTTTGTAGTTTGGATAATTGCTTGTTTATTTTACTTTAATGTTTCCCTTTCAGTCAATGCTCTCCCATATACAAACA
ACTTACAGTTTGTTTGAAATAACATCTCTTGAGCTGATAGTTAGAGTTATCTGGGTTTTGTTGCATTCTGTAATCTCTCAGGTATATACTCAGAAACTTG
TAAG
chr4_7631202 C M C GSVIVG01036033001 Protein kinase superfamily protein
CATGGAGTAGAATTGAAACAACATGAAAAACATTAGGTGCACTACTTGTTTGTGCTAGAGAAACACTAGGAATACCCAACAGAGAATTGGATTTTAACAG
TTTCAGAAGGTGATTCATCTACTCCTTGCTGAAGGGACTTGACTCTGATTCATTGACAGCAGCATTGACCTTGGGATTTGAACGATTGCTTCTCTCTCCG
GGCTTGCTGCTCTGCCAATTTGCTGGTGTTCCATGGATTTTCCAGCAAGTTTCTCAAGTGTGGCGCAGTTTGTTACAATAATCGCATCAGACCCGTGGC[
C/A]TTTCTCCAAGCCCTTGCTGAAAACTGGCTGCTTTATTGGCAAAACCTTCAACAACATTGAGAGCAGAACTTTCAACAGTTCCACTATTAGATTTCT
TTCCCAACATTACGTGTCAACGACTTTTTGCCCTTTGAACTTCAGCAAAGACTTCGCTGATTTTAGGAAGAGGAACTCTGCCAATAATCCATCCTCTAAC
CTCATCAAACTCTACACTGAGTCCAACACGAAACTTATAAATCCTATGAGCCTCCATAGTTTGTTTGTAATGATTAGCATCATTAGTGGACTTTCATTCG
TAGT
chr4_8005927 A R A Intergenic
TGTGGGCTCCATGGTGGCTGTGTGAGTTGTGCGGGCTATGTGGTGGTTGTGTGAGCTATGTGGGCCGCATGGTGGCACAAATGGGAAGTGGTTGGTGAAG
ATTGGCAGCTTTGGGACTAAAGTCGGATGGTGTTTCAGTGGTGGAATGAGTGAAAGAAGTAGTGAGAGAGGTGGGTTTGGTAGGTATAGAAAATGAGGAT
ATGAATGGTGATGGGTATGGGAGGCATGAAGAGTGGCCATGAGTGCATAAATCCTATGGGCATGGGTAGGAAATGGGTAGTAGGGCAGCAGGTTGGGCA[
A/G]GTGTGAAGGAAGTAGGAGGTGAAAGTGTGGTGATGTGTTTGGTGGATGGGTTGAAGGTAATAGGTATGGAAATGAAGGTGGCCACACGCGTTAGAC
TCCATGTATGTAAGAAATAATGGAAATAAACTGAAGGTGGATTAGATGGTGTGGTTGGGGAGCATGTGGGTTGTGTGTGGTGGCTATGGGGTGGCTGTGG
GCTGCATGTGCTGGATATGATGGTCATGGGGTGGCTATGGGTTGCATGTAGTGGTCATAATCAGGATGATGGGGGATGATGGTGATGTAAATGGGGGAGT
AGTT
chr4_8891149 G R G GSVIVG01033170001 cyclic nucleotide-gated channel 14
AATCTAGCAGTGTTCAACTAGTAATCATCTGGCTCAATCGAGAAGTCTGGCTCTTCAGGCTTCTGCAGCTTGGGCATTTCAACATCCTTGACCTTTTGAG
CTCCTCGCCTTGTGTTTTTGGCAAACCTTGAAGCCAGTATGGTGACCCCTAGATGCTGCTTTGCCTGAGAAGAATTTGATTTTGTGGAGCTCCCTTCATC
CTCTTGTTCGGTTTCATCTTCATCATCTGCATGGTCATCGTCATCAGCAAAGGAGAATGACTCTCGCATGCTGAGGTTCTTTGCCATTATCCGCTTCTT[
G/A]TACCGGCGCCAAGCAGCCTGAATGAAGCAGGCTGCCCAGGTCCTCCAGTGGTGAGAGTAGAAGCGGAAAGTGTGCTGCAGCTTCTTACTATGGAGA
CGTCTAAACTGATTTGCAACAAACTTGAGATCCTCTGCTCGCAGTGCAAAGGCTTCCACCTCAACAAGGGCTCTTACTGTTCTTGTTGAAGAGGGCAAGT
TCTGAGTAATTTTGGGAAGTAATGCCCATGCAAGCAACTCCTCCCCGCAAAAATCGCCTGGCCGTAAAGTAATTGAATTGAAGAAACCTGTTCTGCCTCC
ATTC
chr4_10404144 C Y C GSVIVG01035204001 auxin response factor 8
TTGATCTGCCAACTTCACAATGTCACAATGCATGTGGGTCTTTACCGAATTTAATAATGTTGCAATTACAATTGTGGATGTATTTTAGTGAGAAGGTTTG
TAAAATCTGCAAGGGAATTGATTATGTTGTGAATTATGTGTGTGGCATTTCAGGCAGATGTGGAAACTGATGAAGTGTATGCACAAATGACTTTGCAGCC
ACTTACACCGGTAATCTTGAGTTTCTAGTTCCAAATTGAGTTTCAGTTGTGATGTTTAATTATTTCCTTGAGTTATATTGAGTTGGAAAATTGTTTGTT[
C/T]TCTGGTGTATACAGCAAGAGCAAAAGGATACATTTCTTCCTGTGGAGTTGGGTATCCCGAGCAAGCAGCCCACCAATTACTTTTGCAAGACTCTCA
CAGCAAGTGATACTAGTACCCACGGGGGGTTCTCTGTTCCTCGTCGCGCAGCTGAGAAAGTTTTCCCTCCATTGGTAGTCTCCTTTCTTATTTTCTTTGG
TTTGATGCTATTCTAATACTGATTTACATTTTAATATTTGGGTTCACAGGATTTCTCTCAGCAGCCTCCAGCTCAGGAACTTATTGCAAGGGATCTCCAT
GATG
chr4_10552054 G S G GSVIVG01035211001 Leucine-rich repeat receptor-like protein kinase family protein
CCACTAACTTGGTGAGGTTAGTCAGCGAAAGAGGCAGCTCACCAGAAAGAAAGTTGTGAGAAAGATCAAGGTGGGTGAGTTTTGTGAGAGTACCTATTTG
ATGTGGGATGTCACCATTCAGGCCAAGAGAGCTAAAATTTAGTCGAACCAGATTTGGAAATGAAGAGAAGTTAAATTGGGTAAGCAGCCCATTTTCTTGA
GTTGGAACCGCCCAAATCTCAGTGACACTTCCCCCCGCATTACAGCTTATGCCTGGCCAATTACAATGGCCTGTAGTAGTGTTGTAAGACCGCCACCAA[
G/C]TGCTCCTGCGCAGAGCCTCACCCTCAATCCATGTCTGTGATGATGCTGCTGCTGCCGCGGCCATTGCAACCACCCACATTACTATCACTGCAGAAA
TGGAGGAGGCCATGTTTAATCATGCAATTGTCTGTGCTCGAGACTGGGAATAAGGACTTAAAATATGGGCGAGGAGAGTCTTGAATCAAGCACACTGCCC
CTCAAGTCATTAGTCTTCGGGTATATTTCTCCGTCAATATTGCTGCAAGATTTTTGCCAAACTTCATCTTGTTTTCTTCGTCAAACATAGTAGGATTTGT
TTAT
chr4_11452728 G R A GSVIVG01035253001 SET domain group 40
TGCAGCAATGAGTTATCATTAGGGTTTTTTTATTCTTTGTCCTTTTTGATAATTTTCTTGAGCTTCTAATTGTTTTTAGTTTCTTGGACTATAAACAAAA
TGCTCAAAATAACACAAGAAAGTCATAAATAATGAAACCGATCATCCAAAGGGCAACAGGAAGCTATCATACTACATAATATTTGCTTTCAGGAAATCAA
GAAAGTTAGCAATACCTGCTCTCCTTTTTTATAATTTTTCCTAGCATAGAAGCAATATGCAGCAAGATCTTCCTTGTAGCCCCCATCTGTTAACCTCTG[
G/A]GAGAGAACATCATCTTGCTCTGCATCTGAATTGCTAGTAGCATCCTTATTCCAGAAAGAACTATCTTGCAAGGAAGATTCATTTCTTGAACCCTTC
AAATCTTCCCAGCCACATGGTTCTTCTCCAGGGGCAGCATAATTGTAGAAGTCCCCAACAGGGCATAAACATCCAGCGTCATCCCATGGTATATGCATCG
TGCGTGAGGATACCTTCAAGCATATTGAAGTCCAAATGTTTTTACTATTGCCAGTAAGAAACAGCATAAAAAGAGAGAAACACAAGTGTAGAATGGTACA
TTGT
chr4_12174593 T Y T GSVIVG01001480001 Haem oxygenase-like, multi-helical
AGAAGTGGATTGACAACTATTCTTCTGAAGGTTTCCAGGTTTGTACTTAGCAGTGAGCATTTTTATTTTATTTTAAAATTGTCTAACTGTAAATCTCTGC
TGACGCCATTCTGAGAGAAGTATACTTTACATAAATGGTTTTCTCACTCAGGCAGCTTAACTAACTTGTTCTTTGAATTTAGGGTTCAGCTTTACAAACT
GAGGACTTGCTGGATAAACTAAGTGTCTCTTTGACAGGCGAAGAGCTTGACATCATAGAAAAGCTTTATTACCAAGCTATGAAACTTGAAATAGAGTTC[
T/C]TCTGTGCTCAGCTGCTTGATCAGTACACTATAGTTCCTCTAACTAAAGGGCATGACCCTGCAGCAGATCGTCTTGTGATATTTTCTGATTTTGATT
TGACATGTACAGTTGTTGACTCTTCTGCCATTTTGGCAGAGATTGCAATAATAACAGCACCAAAATTTGATCAGAATCAACCTGAAAATCAAATTATTCG
GATGTCCTCAGCTGACTTGAGGAACACATGGGGTGTTCTATCCAAGCAGTATACTGAAGAGTATGAGCAATGTATAGAAAACATTCTGCCATCTGAGAAA
GGTA
chr4_12232042 A M A Intergenic
AGTCCACACACACCCCATGGCCACCATATGCAACCCACACCTCCCTCACAGCACATACACAACCCATAGGTAGTCCACACACACCCTATGGCCACTATAG
CCACCACATGCAACCCGCACCTTCCTCACAACACACACACACACAACCCATAGGTAGTCCATAGGCACTCCATGGCCACCATGGCTACCACATGCAGCTC
GCATCTTCCTCACATCACACATACAACCCATAGGTAGTCCATAGGCACCCCATGGCCACCACATGTAGCCCGCACCTTCCTCATAGCACATACACAGCC[
A/C]ATAGGTAGTCTACATGCACCCTATGGCCACCATGGCCACCACATGCAGCTCGCACCTTCCTTATAGCTCACCCATGCATACCTCACCTTCACACGC
TCACCCACATGCAGCCCACACACCTCATAACTCACCCATGGTCTCCACGGCTCATCCAAAGCCACCCCATGCATCCCCATCTCACCACAGCTCACCCATG
GCCTCCTCACCACCACCATGCACCCACAACCACCCTTAAGGCCACCATATAATTGATCTTTGGTAGTTGAATTTTTTATGAAGAGTTATGAAATTTGTGG
CTGT
chr4_13019589 A W A Intergenic
GCTAAAGAGCTAGAGTCTATTTAATTGACAAAACAAAATTTCTAAATTGGTGGATTCATCCTCCCCCAAAGGCATAAAGAGGAAAGTCTTATCCAGAAAC
CATGGAATCCGCCCCTCTTAACTAACTTTCAGAAATGGGAAAATCATCGAAAAGCAGCCAGAGAAAAGCTTATCAACTATTTGCGAGAAAAGTCATGGAG
GTTTCCTCCGAGAGAACCTCAAACTGCTGACTATTTGATTTGTTGGACTTTGACTATGACGATTCAGGCGAACAATGGGGAAAAGAGCACATGGTTATG[
A/T]CAGTGAATAGAGATGCATGTGAGTGGGCGGTGGGCGCTGCATGTGATCACGTTGGCCTATATTCATGAAATGTTGCTTTCATCCAGTGCTACGCCT
GCCAGCACTGCCACATGCTGCTAATTCCTTCTGGTTTTTCTTGAGCTGGATTTTATAATTCCATCGCTCCATGTTAAAACTAAAATATTTTAAATCACAA
TACGTTTCCACCATTTGAATGCCTTCCGTAGTACAAATGTGTTGGACAGTATAGTTGGAGTAATGTGTATGAAAGAGAAATACACAATACCACTTTCCCT
TTAA
chr4_15481952 G G K GSVIVG01026388001 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
CATAACAATATCCTTCTACAATGAGAAAGAGACATGCATTATTAGACCCAACAGAGTACGTAATTATATTACTAGTCTTCCTCCAGCGCCAAACCAGGCT
CCTGCAGTACGAGTTGAGCCTTTTCCTGAATGAGCTTCCATAGACTATCAACATGCCTAATCTCAGTCAATGTGGACCCAATTGCACAGCGTATGATATA
AATCCCACCCACCACTGCATGAGTCATGAATGCAGCACCACTTCCATTGACAGCCATTAGCAGCCTTGAGTTCAGTTCTGTGCCCTCCCCTTCTTCTCT[
G/T]GGCCTCAGTCTGAAGCACACCAGTGCAAACCTTCTCGGCACCACAACCTCAAATCTGGGATCTGTGGCTACATGTGCCTCGAATCGCTTGGCCAAG
TTTACATCGCTGCGTATATGGAACATGAGGTTGTCCAAGCCATGCCTTCGAATCACCACCCAAACTTTGATGGCCCTGAATCTTCTACTTAGTGCTATTT
GCCAATCTTTGTAGTCTATGACCTTCTTTGATTCGCTTGCATTGTTCCTCAGAAACTCAGGAGCAGTTGATAATGAATCCACAAATAGCTTTGGTTCTTT
AATC
chr4_15703114 A G R GSVIVG01026406001 Protein kinase superfamily protein
TATCAGTTGTCTGAATAATTTCAGGTATGGTTTCAATTTCTGAGAAATTCATACAAGATTTTTACCTAGCCAGAATCATAGTTGGTAATTTTTTTCCCTC
TTGATGACCAGCCTGAAATTTGAGTCTACTCTTGATTTTGCAGCTATGGAAGGAGGAATATACGTGGAAGATTACCTATCCAGAATGATCCAGGTTGCTC
CTAGTTCTCCGGCTTTTGTAGCAACCGCCCCCATCTCTGCATCAGCTAGAACTTCAGCTGCAGTTTGGACCTGTCATCCGATGATTGATCATATAACCC[
A/G]ACAACAATTGTTACAAAACAACACTGTGAGAAGGAAACACCCCCTGTACCTGCTTGACATTGTGGGCTAAACACAGTTGCTGCATCATCTGAACAC
AGACACCGTTGATTCGATTGGATGCATCATCCTGAGCTCTATTAACAAGGCCCGCCTGATCAGATGTTGAACTCTCCTCCTGCCTAAGACCCAGTTTCTT
TAGCAGACCTGAAGCAACAAAAAGAATCAAAACATGGAAGACATGGCTAACAAAACTGTCCAAACCAAGCAGAAAGGAGAAATGGAAACCTACAAGAAAG
AAAC
chr4_17390204 G R G GSVIVG01019047001 AINTEGUMENTA-like 5
ATCCACATGTCTTAACATTTTCTTATTTCAAGACATTGAGAGCTTTGTCTATTCATTTGTAATACAATATTGTTACAGACACCACCAGCATGGGAGATGG
CAGGCAAGGATTGGAAGAGTTGCAGGCAACAAAGATCTTGACTTGGGAACTTTCAGTGAGTATATCTATAATTCAATATCCCCATCTTCTAAAATGACAA
AGACCTTTGTAATGGATTGTTTTTCCTTTTTCTTTTTGCAGGCACCCAGGAGGAAGCAGCAGAGGTCTATGACATTGCTGCCATTAAGTTCCAACATTT[
G/A]AATGCGGTGACTAACTTTGACATGAGTAGATATGATGTTAATAGCATCCTAGAGAGCAGTACATTGCCGATTTTTAGCTGCGAAGTTGTTCAAAGA
TGCTGAGCAGGCTGAAATGACTACAGATGGACAGAGGTCAGACGATGAAATGAGCTCACAGCTGACTGATGGAATCAACAACTATGGAGCGCATCACCAT
GGCGTGCCTACTGTTGCATTCCAACAAGCTCAGCCATTTAGCATGCACTACCCTTATGGCCATCAGCAGAGGGCTGTTTGGTGTAAGCAAGAACAAGACC
CTGA
chr4_18007386 T Y Y GSVIVG01018993001 U2 snRNP auxilliary factor, large subunit, splicing factor
CTTGCTGCAACACTTGGTCCAAGTCAGCCCAATCCCAATTTAAACCTTGCTGCTGTGGGCCTAACACCAGGTTCTGCTGGGGGTCTTGAGGGTCCTGACC
GCATTTTTGTTGGTGGGCTCCCCTACTACTTCACAGAAGCACAGATCAGGGAGTTGCTAGAGTCTTTTGGTCCTCTTCGGGGTTTTGATCTTGTGAAAGA
CAGGGAAACTGGAAACTCCAAGGGCTATGCATTTTGTGTTTACCAAGATCTTTCTGTTACTGACATAGCTTGTGCTGCATTGAATGGAATTAAAATGGG[
T/C]GATAAGACTCTCACTGTTAGGCGTGCAAACCAGGGTGCTTCCCAACCTAAACCCGAGCAAGAGAATGTATTGTTGCATGCACAGCAGCAGATTGCT
TTACAGGTGGAAAGAAACTTCATGTTATCATCTCTATTTATTGGGAGATGTTGCAAATTTGCTGTCAATCTTAAAATTAAAATATTATGCAGTAATATTA
ATTTTGCATTTTATTTCAATGGTATTCTTGTTGCATATTATGATCAATAACAGCAAGTTGTGATGCTGCAATATTTTTTCTAAATGGGCTGTACCTATCA
AACT
chr4_18050520 C Y C GSVIVG01018987001 Protein of unknown function (DUF620)
GTCAGATTGGACAACTCCGTCCACCGTCCCATCAGAGATAGTTCCATTGTAAGAACTAAGAACCTTCCCTTTCAGATTCATCTCCATACTTGTTTTGTCA
TATCGTACGTCATGATTCATGAGTTTGCCATTGACCCACCTGGAGACACGCCGCTGGAACTCCTGCATGGTTGATCTCTTCAATGTCATGCATATTTTGA
GGCATGTAATTCGGGTCTTGGTGCAAGTATGATCAGCAGCTTATTTTGGAACCATAATATTGAATCTTGCAATTTAATTAATCATCTCAAGTCATTGTC[
C/T]TCCATTTTTTAGAACCATTTGAGGAATATTGTTCCTTCTTTCCAGGAAGCTTCCACAGCCAAGTATATTGTACAACAGTATATAGCAGCAACAGGA
GGGCAACCAGCGCTGAGCTCAGTGAACAGCATGTGTGCAATCGGACAGGTGAGGATCAGTGCATCAGAGTTTTACCAAAGCGACCTACACGTGAAGGTGG
GTACTACTGAAGAGATCGGAGGATTTGTGCTTTGGCAAAAGAATCCGGATATGTGGTGGTTAGAGCTCGTTGTGTCAGGTTGCAAGGTGATATCTGGTAG
CAAT
chr4_19181713 C Y C GSVIVG01018858001 Methylthiotransferase
CGAGACTATATTTCTTTAAGATGAAGACATATATATGAAACAATTCCATTTTAGTAAGTTTCTTTACACTGGACGAACAAGCTTCCCAATTCGAGTAGTC
ATAAAATGATCTTAGTCCCACCATGTATGTTGGACAAATTGGACGTACATCCATGCCCCAAATTGCTTATTTTTCATTCCATAGTACTTTTTTTTCAATG
AAGGAAACATCTATTAACTACTTATCGGACGTAAGATGTATCACAAGGGGTCCAAATGCAAAACGCAGCGTTTTGTGGAAACAGAGTAATCGAAGAATC[
C/T]CTTGGCTCGCCCTATCCAACGCAGTACGCACACTCATGGCGTCTCCTCTCTCATCGCTCTCGTCCATCCTCTCCCAACCTCACTGCGCCATCCGCA
TCAGACTTCCTACGCGATGTTGCTTCGGTCTTCAATCTCTCTCCCCAAAACCCCACCTTTCTTCTTCTCGCTGCAATCTTCGTACTCCTCCCCCTTTCAG
GCCCGGTTTCTCTCTCACTTTCTCGAGAAAATTCTCTCAATCCCATTCTCACCTTCCACTCTCCAACAAGTCGGAGGTTCCCAGCCTCCACTCCTTCATT
GCTC
chr4_20559130 G G R GSVIVG01003838001 serine acetyltransferase 3;2
AGGTAGTCTCTTATTTGAAAATCTTTGAATCTGGAGCAGCATTATGACCATATTATATGGATTTGTGCCTTTCCTATTTCTCCTTTTAATCTGGTAACCT
TTATTTATTTATTTTTGTCTAGGTTTTTGGAGTTGACATCCATCCAGGTATGTATTTGCTCAAATTTGTTTTATTGGATAGATATCCCATTTACAATTTG
TAGCATATTTTTCATTAAGTTTATTGTAGGAGCGAGCAGCAACATTCCTTGTAAAAGGGATGTAACTTTTGAGAAACCTATGGTGAAATCAACTTAAAT[
G/A]TGTTTACAGCTTACCTGGTACTTAGATATGATTCTTGTTTCAATGAACAGTTGCTGCCATTGCAAGTCTGGAACGATCTTTTTTAACTTGTTGGTT
TGTAGCTATGCGAGATGACAAAGGTTTCCTGGATGATATCCACTATGAGATGAAATTTTTCCTTTTTAATTAAATTTGGTGATTCTGTACAGCTGCACAA
ATTGGAGAGGAAATACTTCTGGATCATGCAACAGGCGTGGTTATAGGTGAAACTGCTGTTGTAGGAAATAGAGTTTCATTAATGCAGGTAATTTGGCTTC
TATC
chr4_21141468 G G S GSVIVG01026605001 nodulin MtN21 /EamA-like transporter family protein
AGACATGGCCGCCTCCCACCATCGTTGAAATTAGTGAACTCACCATGACCAAAGCAACATGCCCATGACTTTTCTCCACTTGCGTGTATGAGGTTCCCGT
AATCGAATTGGTAATCCAAGACCATACATGGTGGTTGTAGACATGATTTGGGCTTGGACTTAGAGGAAACTTTTCGCCAGCCAAGCTGCCTTTTTAAGAG
TTTGTCCTTTTAAGAGTTTTGCCTACGATAGACCGCAATACGCCTGCAAGGACGTCAGCAAAAGGACCCCCACACATCACTTTGGAAAGCATGATCTAA[
G/C]TGTGGATTCTGGATTGCTCTATCTGACATGATTCCAACAGCCGGCAGCTCCACTATTATGAGGGCGCCTCTCTCAGAAATCCCTTTTTGTCTATAA
ATACTCATATGGTTTGAACCAGAGAGTATCCAAACAGCCTCCCCAACAGCTTCATTTGCTTCATATATAGTCATTGGCTTGAGCTATAAACAGCTTTTCA
GTTGGTATATTACATGGCTAGTGGGAAGTTTTGGAATGTCATGACAGGGCTGAAGCCAGTCCTGGCAATGGTGGTGGTTCAAGTGTCACTGGGAGGAATT
AATA
chr4_22484721 T Y T GSVIVG01026504001 RNA-binding (RRM/RBD/RNP motifs) family protein
CATAAACATATGTGGAGATAAACATTTGTGAAATAAAGAATTTAATCCCAAAAAAAAAAAGGGAAATTAAATTCATCATCTTGAAAACACCAAAATTTGA
TGTATTCTTGGATTTTCTTTTAGATACAATCAAGATGGGTGGTGGGAGGATATTTTTTTGGCTCCCTTTAGCTGCCCTTGCATTAGAATTACCTGAATTG
CAGCAGTTGTGGTCCTTTCCAGAATAATGCCAATAGAATTGTGGTCTTTTACAAACCTGAGCCCGTAAACAACTTAGTAGTTTGAGCTTTGATTGTCTA[
T/C]ATGGAAATTTCTTCTCTAATCAGCAGCCAAGTTAGGCAATTCTGTAGTATCTGCTATAATTAAAATGGGAACCACACTAAGGTTCAAGCTAGACAG
TGGTTGGCTATTCTAAATTTTTGTGTATCTTTAGGGATTTTTGGAACACAATCAATCTTTTTTCCTTGTAAATTTTTTTGCAGATCACCAAGGGGCCATC
GATCCAGGAGTCCCAGGAGGAGATACTAATGTTGATGAGTTGTGTGTTCTATTTTGAGGGTGTGGATCTTCTGTAAGAGATTTGAGAGTTGACATTTGTT
CTGA
chr4_23597803 G R G GSVIVG01026444001 hydroxy methylglutaryl CoA reductase 1
TCTTAAACCCTCGGATGCACTGCCACTGCCTCTCTACCTTACAAATGGGATATTCTTCGCCTTGTTTTTCTCCGTGGCCTACTTCCTCCTCCACCGTTGG
AGGGAGAAGATCCGTACGTCAACTCCTCTGCATGTTCTCACCCTCTCTGAAATCGCTGCCATCGTTTCCATGCTGGCGTCTGTTATCTATCTGTTGGGTT
TCTTTGGCGTGGACTTCGTCCAATCTTTGGTCACCCGGCCTTCGGGTGATGTTTGGGACGCGGAAGACGAGCCCCACGGCGCCATCCTCGAGGAAGACA[
G/A]TCGACCCGGGCCTTGCGCGGCAGCCATTGATTGTTGTCCGCCTCCGAAGGTGGCCGATGTTGCTCCTGTGACGGTTTTTTCGTCAGAGGAGGAAGA
GGAGATGATCAGATCGGTGGTGGCGGGGTCTGTTCCATCCTACTTGCTCGAGTCAAAACTGGGTGATTGTAAGAGAGCGGCAGCGATCAGAAGGGAGGCC
TTGCAGAGGACCACAGGGAGGTCTCTGGCGGGGCTGCCCTTGGATGGGTTCGACTACGAGGCGATACTGGGGCAGTGTTGCGAGATGCCGGTTGGGTACG
TGCA
chr4_23692987 C C Y GSVIVG01026427001 Auxin efflux carrier family protein
TGCATATTTATATAAATATGTGCAGGTGATTCATGCCACTCAATATTCTGACCACTTTTATCATTGGCTCAGCACTTGGCTGGATGCTTAGAAAAACTAC
TAGAGCCCCTCAAGAGCTGCGAGGCCTCGTATTGGGCTGCTGTGCTGCAGGTAGGTATGTTTGCAAATCTTTAAATGTTCTTGATGGTTATAAGTTTGAA
TGACATGTACCATAAGGATCAAGCTTATGGTAAAACACCAGGAACTCCTCAAGAAAGGAAAAGCAGAGGTACAGATAGTTATGACGCATTATGGTTCAC[
C/T]GTATAATCAAATAACATGTTGTGCAGCTTGTAGTTTTAGATTTCAAAGAAGTTCAGGGCAACATTTTGATGTCCTTGTGTTAGTGATGATCTCATA
ATTCATTTGTAGCTAGACCAGAGTTCCAAATTATATTATCTGGGGTTGATTTTAACAGGAAATTTGGGCAATCTGATTCTCATTATAATTCCAGCAGTCT
GTAGAGAGAAAGGCAGTCCGTTTGGAGCAGTTGATATCTGTTGCAGACATGGATTGACTTATGCTTCACCGTCCATGGCGGTATGATCTTTAATTCTCAG
CAAC