Home > MAB      


Information

Crossbreeding combination : 146 X     Marker selection method (distance) :
Search

MAB viewer     Marker(#) : 180


MAB marker Information     Marker(#) : 180

Chr. No. SNP position Ref Perennial Dempsey Left Right Sequence Primer Size TM Product Size Detail info
chr01 7,003,342 G A G
AAGATGCGGCTACGACTGTG
CTTGAAGTCAATGCCCGCAA
20
20
20
59.4
116
ACCTTTGTAGAATCTGTATTGCTTGTTTTTGGAGATTAAAGCTTTAAACTTTCTACTCCGTTTGAACTTAACTAGTGATTTAAAGACATAAAATCTTCAT
CACAAGTTAAAGATCACTCGGTTGACAATTAGAAGTCATAAAAACTTCATTGTTAACTAGAAACAAGAGATGTTTAAGTTATTTCAACTTGTTAATAAGT
AGTATTCTGAAAAGACTAAATTTTATTGTCTTGTGGTGACAGGAAAAATGGCTAATGAAAGTCAAATGCAAGATGCGGCTACGACTGTGGGGACAACTA[
G/A]TATTGCCTCAACAAGATGAGCAAATGCTCCGCAACCAATGGCACCTGCGGAGAAGCCCAAAAAATTTGCGGGCATTGACTTCAAGCGATGGTACCA
AAAGATGTTCTTTTACCTCACTACCCTATGTTTTCAAAGGTTCACTAGTGAGGATGCTGCTGAGGTGCCTGAGGGAACCTCAGACAAAGAGCATTTCATG
ATTGTAGAGGCTTGGAAGCACTCAGACTTCCTTTGCAGGAATGATATCTTGAGTGGTCTCCAAGATAACCTCTATAATGTTTACAGTGGAACTAAGACAT
CGAA

chr01 27,500,175 G G A
TGTTTGGTTATGCATCCTCAA
ACATGAATGGCAACTGTCTGA
21
21
21
57.86
146
TATAGTAGATCCACACAACTAACGTTAGTACTCGAGGCACGGTACTAACACCCTTACAATTGGAGTTATAGGTTGGTCCCCAATTAGCTCAGATTGAGGC
ATATCGGTTAAATGATACCTCCTACGGTCTCAGTCCAGTAATCAGTTCAGAAATTCATATTTAGTTACTTGACCATATCATACAGATATCAGTGATTCAG
TTATCAAATTTTAGCATTTCAATATTTACAGATTATGTTCAGAACATGTTATATGTTTGGTTATGCATCCTCAATACTTATAGATTTCATAAATTCTTA[
G/A]TATTTTACAGATTTCACTATTCTTATTATTTACAAATTTCATGCACTCTATTCTGTACTTTATGTTATACCCATATATTCAGACAGTTGCCATTCA
TGTTCATGGAATCATGTATATCAGCCTACCTTATTTAATATACCAGTACATTCAAAGTACTGATCACATACTCTTTTCTTGTGCTATGATGTATCATATC
ATAGGTTCGGACACCCAGTTCCAGGATCGCGCATAGACTTCCCATATTATCAGTAGTAGGGGTGAGTCCTCATACTTTGAGGATAAACTATAATTATTTT
CATG

chr01 42,503,755 C A C
TGCCAAGGAAAGCAATGGAG
ACGACACCTTGGTTTACTCT
20
20
20
56.41
141
TTAGACCACAAGAATTTTGCCTTTTTCTGAGTCAACTTCGTAAGGGGGGCAGCTATGGAGGAAAAACTCTTTACAAATCTTCTGTAATACCTTGCCAAAC
CCAAAAATCTCCAGATATCGATTAGAGACGTGGGTCTGGGACATTTTCTCACTGCGTCAATCTTTTGGGGGTTAACCTTAATCTCTTCACTAGAAACGAT
ATGCCAAGGAAAGCAATGGAGTTAAGCTAGAATTCAAATTTGGAAAACCTTGTATATAATTCATGATCTTTGAGGTTCTGAAGGACATTCCAGAGGTGA[
C/A]TACCATGATCTTCCACATTCTTAGAGTAAACCAAGGTGTCGTTAATAAAGACTACGACAAACAAATCTAAAAACCGATGAAACACCTTATTCATTA
GGTCCATAAAATCTATGGGAGCATTAGCCTGAAGGACAAAACTAAGAATTCATAATGTCCATATTGAGTTTGGAAAGTTTTTTTTAGGAATGTCAGCCTC
CCTTACCTTCAACTGATGATACCCCGAATGAAGATCTATTTTGGAAAAACATCTAGCACCTTGGAGTTGATCAAATAAATCATCGATTCTAGAAAGAGGG
TATT

chr01 55,000,076 G G T
TGTTTGGTCTTGCATTCTCAGA
TGGTATATGAGATGAGGCTAGGC
22
23
22
58.97
132
TGGTACTGACACCCTTCCAACTAGGGTTACAGGTTGGACCCCAATTTGATCAGATTGGGGCATATCAGTTAGTTGATACCTCCTACAGTATCAGTAAAGT
ATTCAATATAAGTTTAGTTCAGGATTGCTTGACCAAGTGTACATACATTCATTTGTTTAGTTATACAATTTACAGTCTTTCAGATTTTAGACTTATTTTA
TATTACATATTTATGTTTGGTCTTGCATTCTCAGATATCACAATTTTCATGCATTCATGTTCAGTTATCTCGTGCTATAAAGTTAGTGCTTATTTCATA[
G/T]GCATAGTACCCTATGTATATTAGCCTAGCCTCATCTCATATACCAGTACATTCCAAAACTGACCACTTATTCTTTTTTGCGCTATGATGTCTTATA
TCATAGGTTTAGAAGAATAGTTTCTCAACCGCAATTAGACAACTCAACATAATCTAATAGCCTTAGTGGTAAGTTCCCATCCATGGAGGATATGTTATGA
TTATTCAATTATTCTAGTATTTCATTTTACTTAGTCAGTCGAAGTTAGTTGGGGGTCTGTCCCATCAACTCCTCAATTAGTTTAGAGGCTTTCAGACATG
CAGA

chr01 57,500,891 G G T
AGTAGCACTAGCCGTGGAGA
GCACATGCAACAAGTGAAAGAG
20
22
20
58.95
106
AAGAGGCAACCGGAACCTTGTTAGCCCCAGAAGCCATTCTAACATAACAATCACGCTGTATATGACCAATCTGACCCTAATAAAAATATCTGTTCTTCTT
TTCCTTACATAAACCATGATGCGATTGCCCATAAAACTACAAGGCGGGTAGGATAGAGCTGATTGAGCCCTATTAGCCTGAGATTGGGCATTATGTGCCT
AGAACCACCATCATACTAAGACCGATGATTGCCTGACAGCTTTAGGTAAGTAGCACTAGCCGTGGAGAAAGAACCAGAAATCCCATCATTTCTTTCTTG[
G/T]TTTTTACTAAATTCAATCTTATTTTTCTTTTTCTCTTTCACTTGTTGCATGTGCACAACTAATCTAGAGATTTCCATGTCTTTGATTAACAAAGAT
ACCTTACTCTCAAGAACCAACTCACGAGACAGTCCCAAAGCAAACTTACGCATTCTAGTCCTCATGCTAGAAACCAACTCAGGAGCATACCTAGACAATT
GATGGAATTTCAAGGCATACTTCTTAGCAGATATTCAACCTTGCCTCAAATTTACAAACTCTTCTACTTTAGCTTCCCTCAACTCCTGAGGAAAGAAGCG
GTCC

chr01 103,501,876 T C T
GAAGCATGGTTTCACGACCG
ACCATTGCATGTTCAGTCAT
20
20
20
55.61
120
TCAAAGACTAAATTAATACTAAGTCTAAATACTTAGCTAAAATATTCTAAGTCTGGGACCCCTTGTCAAGCCTAAAGGACTGATTTAAGATAAGAATTTT
GTGGGGTCTTACATTATCTCTCCCTTGGGAACATTCATCCTTAAATGAGACTACTGAGACTAAGAATACTGAGAGGCTGGGCTTAGACACTGGGCATGCA
CAACTGAAGCATGGTTTCACGACCGAGATCACTGATATACTGAATTATTATACTGAACATGCATATTTGATGCATGAATACATGACTGAGCTGATTCAT[
T/C]AACATATGACTGAACATGCAATGGTAAATGATACCAGGTTTGTAACTAAAATCTAAACATAAAACTGAATAAGCTTAGGGAAAACTATTACCTTGA
GTTGAATCTGAGTTTGCGGAAAAGAGGTGAGGATACTTGGTCCACATATCTGCTTCTGCTTCCCAAGTAGCTCCCTTAACGTACTAATTCCACCAAAGAA
CTTTGACTAGAGAGACTTTTTTGTTTCTCAGTATACGAATCTAATAATCAAGGATTTTGACTAAAATCTCTTTGTACGAGAGGTTATTCTGAACATGTAT
GCCC

chr01 106,513,441 G G A
TTGGGGCATCACAACCAACT
TGTTGCAGAATAGGTGCGTT
20
20
20
58.11
96
CGCTTGGCCTCAGTATTTTTTTTCGACACATTTACTGTTCACCACTATTCACGGTTAGATCAGAATGATCATAACTCATCGCTCGAGTGTTCGTTTTGAA
TGATCAACATATCGTTGGAAAGCTTATTCGATTATCTACACGAGACAGGTCGCATATCCAGAAATTCTATACAGAAAAATTATTAATTATGATAAAGAAC
AAAATTCAACACATTTTCGTCCGAGATCTTACCGGAAAATTTTTTTGGGGCATCACAACCAACTCCTACTGCAGTCTCATCATCACCAACTGGGGCATG[
G/A]AAAAGATGTGCTAACATGTTAACGCACCTATTCTGCAACATAAAATTTAATCACTTTGAATATCATCAGTACTTACTCAAAATCATAAATCATTAT
CTCCTCTCTCCATATTTATACGATATTATTTCTGTTTTACAACTCCAGAATGTTTAATCCGGTTCAAAAACAAGTATTATTTTCCCATAAGTGTGTTTTT
AATCCAAAATCATCTAACTGTATCTAAAATACCAAAGGATTTAAGTTATAGGCACTGTATTGTGTGTAGATCTACCTAGTTAGTTTCAACCTCTACAGAT
CATC

chr01 125,526,253 C A C
AGGCCAAATGTTTCTCCCACT
TGATCGGTCGTTGAGCAGAC
21
20
21
60.11
94
ACACATGAAGAAAGACTCGATCACCAATCCTAAATTGTAAGGCACACAGTCTAGAGTCTGCAAGACTCTTTTGCCTACTCTTTGGATGCCCAAAGCATAT
CCTGAATCATTTAAACTCTATCCAAAGACTTGTTAAGCAAATTGGTACCACGAAGATAACCTTTAAAGTCTCAAACTAACCAATAGGAGATCGACAACGC
CTACCATACAACACCTCAAAAGATGCAATCTAAACACTCAAATGGTAGGAATTATTATAAGCAAACTCTTCTAAGGCCAAATGTTTCTCCCACTAACCT[
C/A]TAAAGTCCATAACACATATGTGAAAAATATCCTTCAAAACCTGAATAGTCTGCTCAACGACCGATCATTCTAGGGGTGAAAAGTTATGTTAAGATC
AACTTGAGTACCCAACTCCTTCTGAAGATGTCAAAAACTAAAAGTGAATCCTGATTCTTTATTTGAAATAATGGACATAGGTACCCAATAAAGACGAACA
ATAAACAAAGATACGAGCCAATCTATTAGTATTAAAGAAAATTTGAATAGGCACCAAATAAGCTGACTTGGTCAACCAATCAAAGACAACCCAAATGCAG
TCAA

chr01 141,504,976 G A G
ACCCTCTTGAGTACGATCTCTCA
TGGTAGAAAGTGAACCACCA
23
20
23
56.3
150
TTCCCATCAACCTGTGACACAAGAAAAACACAAATTATCTAAACTCAGAACTAAAATACTGAAAATAAAATACCTACCTTAACTTGGGTTGCCTCCTAAG
CAGCGCCTAATTTAGTGTTGTAGCACAACCCAACATCATTACTTAGTCGAATTCCTTTATCCTCTTCCTCTTATTTGGAGGCCATTTTCTTATTCTCTTT
TACCCTCTTGAGTACGATCTCTCAAGGTCAAAATTTTTTTAAATTTTATCTTTTTTAGGCTAATTAATCCTCATCAACTAAGGATTAGTTGGTGTTTCA[
G/A]AAAACTCAATGAGAATTTTTAAAAAAGTCTTTGGTGGTTCACTTTCTACCACCTCACACTTATCCACTTCTATCACTATAATCATACACAAATCTT
TAAATGGGTCTATGTATTGAGCGGCTTATATAGTCTGAAATCTATATCTTCATCATCCAAGCTCATTTTGAGTGTTTTCTCTCTCACATCTATTAGTGAA
CCTCTCTTCACTAAGAATGGATGTCCCAAGATAATTAACACCTTGTCATCTACATTATAATTCAAAATAATAAAGTTTGTAGGAATAATAAACTTACTGA
CCTT

chr01 179,000,032 T T C
GCTGGTAAGGCTCCTCCATC
TCGCCAAGTCCAACTTCTCC
20
20
20
59.97
149
AGAGGGTGTCCTCCATCGGTTCTTCTTCCAGCGAGAAGACTGATTCGAGGTCATTCTCTGTGTTGAGATAGATTCTCGCATGATCGGCTATCTCTTTAAA
GAGGTAGACGGAGTCCTTAGACTTCTTGTCTTGAGAATAGTTTCTGGTAAAGTGGCCAGGCTTTCTGCAGATAAAACAACCATCATCTTTCTTCTTGTAG
CTGGTAAGGCTCCTCCATCTGAAGTACTTGGTTCGCCAGGTAACCCTGCTCCTATCGTCGGGAGGCCTTGGTAGTTTCAACCTCCTGAATTGCAGCTAC[
T/C]TTTTTATGCTTGTCTTGTGGCGAGGACAGGAGAAGTTGGACTTGGCGATGAGGTCATCTTTCCTATAGGCTTGATTGAGGACTAGATTGTTTTTGA
TGATTTGCTTCAGCATGGTCTTCTTGATGCATATGCTATCCAGAGCCTGGAATATGACCTGCCGAATATAGCCTATTTTTGGGATGATTATGGACATGAA
CTTCTCCTTCATAATAGTCATCATGTGGTTCGCTAGCATCATCAACAGTAATAATATGAAGGCTTGCTTCAGGCTGGGATCCCTGCCCTACCCAAAGTAG
ATCA

chr01 189,500,932 G A G
CCCTCCATCTTTCCATGGGT
CTGGTAGGCGGCTAACTCAG
20
20
20
59.9
124
TCACAAGTTAAACTCTCAGTGTAATCCATTCTTCTCTTATTCCAGACCATGGCCCCAAAGAGAAGAAACCAGCCAGCTCCTCAGCCTGAAGATCCTTTGG
GCAAACATGTTTCCCATTAAGAGTTTAGAGCCATATTTATCACACTTGCTCAGTCCATGGATGCGTAAATTGAACGGCCACCAGTAATTCTGGCCAATCC
TAAAGCAGCTAGGGTTCGGGACTTTACCCAGATGAACCCTCCATCTTTCCATGGGTCTAAGTCTGATGAGGACCCTTAGGAGTTCATTGACCAAATCCA[
G/A]AAGGTCATTGACATAATGGGTGTTACTTCTATTGAGAGTGCTGAGTTAGCCGCCTACCAGTTACAAGATATTGCTTATGATTAGTACAAATAGTGG
AAGTCTGAGAGGATAGATGATACAGGCCCTATCAAGTGTGAGGAATTTGTCACGGCCTTCTTAGATAGATTCTTTCCCCAAAAGCTCAGGGAAGCCAAAG
TTCTTGAGTTCATCAACCTCAGGTAGGGGAATATGATGCTTAGGGAGTATTCTTTTAGATTTACTCAGCTAGCCAGGTATGCTCCTTATGTGGTTGCAGA
CAAC

chr01 198,576,915 G A G
GCACCTTAAGCTGATTGTTGCA
AGTTTGAAAAGTCCTGACCGGT
22
22
22
60.09
135
GAGAAGTTAAATTCTCACACCTTAAGCCGATTGTTGCGTAGTCACCTTCTTTAAGCTAAATTGATTGGTCTAAAGGTGTACGAAACGAAGTTAACCTCTT
GCATCTTAAGTCGATTGTTACATAATCACCATTTTGAAGCCAAATTGGTCGGTATTAAGGTGAAGGTGAAGTTAAATTCTCGCACCCTAAGATAATTGTT
GCACAATCACCATCTTGAAGCTAAATTGGTCGGTCTTAACATGTACAGAGGCAAAGTTAAACTCTTGCACCTTAAGCTGATTGTTGCATATTGCTAGCT[
G/A]TTTCAATTCTACAAAAGAAGAAAAGGAGACAACATAAAGGAGACAACATAAAGAAAACACAAGCAGAAGAGAGATTATTACCGGTCAGGACTTTTC
AAACTCAAAAGCCATACATCACCAACTTGGATAGGTGTGAGACAAGATGTCTTAGTAAAAATGAAACTCTTAAATTCTATTTTCTAGAAATCAAAACACT
TTTTGATGAGTGATGGTCCATTGTCAAGATATAAATTATTTGGTATGGCGCCACAAGTCTAAAACTTTCTGCCGGACAGAATTTAGGATCGACTTTAAAA
AATT

chr01 225,504,775 G A G
AGAAGCAATCCTTGTGTTCCA
AACCACCTCATCTACCCTCA
21
20
21
57.36
85
CTGTATGACTAGAGCCAGTGTCATGTTTTCATGACATCCTTAGTCATGCCATGGTCCATAGAACTCAGTCTGTCATGTGACTCAGAAAAGCTCAGTAATT
TAGCACTCTCAATAGCATTCCGTTAGTTAACGAAACTCCATGAATTCAGTCTAGTCCAGTTAATCATGTTTAGTGTCTATTTAGATGGGAGTAGGAATTA
GTACTAAGTGAACTGAAGAATGGAAACTCACCAGTTATATGAGGGTGTAATACTTAGAAGCAATCCTTGTGTTCCAAAACTATGTAGCCAGCATAGGTT[
G/A]AGACATTATAGCATGTTATATGAGGGTAGATGAGGTGGTTTAATCTGCTATATGAGGGTTCCCACTGTTCTCACTAGAGTTAGCTATTATATGAGG
GTTACTTGTAGATTGTCCTTACCAGTGGCACGGTATTGACACTCTTCTAATTGGGGTTACAGATTGGACCCATACTCAGCCATAATGGCATATTAGGGGC
ATGTCGGTTAGATAAATACTTCCCATAATTTTAGTTACAAAATCAGGACGGTCAGATACAGTCAAACAATCTCAGTAATAGAACTCAGATAGTTCTACAG
AATT

chr01 228,004,735 A G A
GAGGACAGAGGGGACAAACA
TAGCGAGAAAGCCTTCACCG
20
20
20
60.11
97
TAATAATAATAATAATAAAAAGAAAAAAAGAGACCTAAACTACCAAAACCACCCCACAATTACCACTTCCATTCAACCTCTCCCCCATTACCTCCACACA
AACACACGACACACACTCACCTACACTATACATACACCACACATGGACAAGGAAAAAAAGGGGGGAAAACAAAAGCAAAAACATTGAAAAAGACCAAAAG
AAATAGAAATAAAAAAAAACGTACACAAGTAGAGCAAACTTAGATAAACAAACAAAAAAAAAAAGAGGACAGAGGGGACAAACAAAAAATAGAAGAGAA[
A/G]AAGAGTTGGGTTTTAGAGTTTGGAGTTCCGTTTGATGTTTTCGGTGAAGGCTTTCTCGCTACATTACTTGATTTAATTTGCTACACAGGTTCTCAT
TTGATTCAACACTTTTATTTTTATAAGTTTTATTGTAAACCAAATTATGAATAAAGTTGTCTAGATGATTTGTTAGGTTATTTAATATGTGTGGTTGATT
AATTATGTTACTCTTTATTCTTGACGTGAGCTATATGTTTAAGTTACTAAGCACTCATATTTTACGCATAGATTTGATGTTTAACATGCTCTTTGTTGGT
TTTA

chr01 248,003,049 T T G
TCTGACCGACAAATCTCCATTCT
CCCCGAAGTTGGCCAGTAAA
23
20
23
60.25
149
AGTCTAATTTTGCTGAGAATATTGATTTTGCTGAAGCTGAAACTCCTGGCATTATAACCTCTTCCGAGCTTAATAAGCTCAAAGGAATGATTAAAAAACA
ACCTGGCAAGAAGTATGCTGACATTCCCCGTATGTCTACTGCTTATTATCCACGCCCAACTCCTCAAGATGTTTTAATAGAAAAAAGGGAATGGAATCAG
ACAAATACTTCTTATAGTGGAGAAGCCATTTATGAATGGAACATTGACGAATTATCTGACCGACAAATCTCCATTCTTATTCATCGAATGTCTATGTAT[
T/G]CTACTATTGCCACAGCCACCACTTCGCCAGAAAATAAAACCACTCGTACTGACCAAACAATTTGTAAAATGATTGTTGCGGGCTTTACTGGCCAAC
TTCGGGGCTGGTGGGATAATTTCCTTGATGATACTAAACGCGAGGCTATTTTTAACGCCACCAATGATCAACCCGGAAAAGACAATCTCGGACGACCCCT
TCGGGCAGGACGTTCGGATGCTGTCTATACCCTTATGCTGACGATTATTGAACATTTTGGCGGAAGATTTACCAATCAATACGAAAATATTAGAACTTTG
CTTA

chr02 10,500,066 G A G
TGCTTCTTAGGAAAGAACCAAGT
CGCACACTTCTCTTATCGCC
23
20
23
59.08
87
CACTCAAAAAAAAAGATCAAAACATCCTTGATCTTACAAATATATTTTTGGTTTTTCTCAAAAATATTTCATTCTTTGTCAATGACATTTTGGAAGTATT
TTTGAATTTTTTCTTCTTCCTAGATAACAAAAATGACTAGATACTTCACCTAAGGATGTCGCCTCATCATCCCTCATGGGGGAATTATCACTCGATTCGA
CAAAGAAACAAAACTAAAATAAAAATATAAGATCAAAAGAAAGAGTAGATGAAAGTTTGCTTCTTAGGAAAGAACCAAGTTTTGAAGAAAATCCTTGGA[
G/A]TTTATTAGACACATATATACAAAAGGCGATAAGAGAAGTGTGCGTAATCGGATACCACATTTATATTAAGAACATGACCAAAATTCAACAACAAAA
AGACAATGTTTGACATCATTATCAAAATGCCCGACAAGGTCTCATCTAAAGAAATGTCAATAGTAATACAAAAACAAGACCAACAAGGGCTAAAGATAAT
AAACATGACAAAATGTAGCGTGTACACACAAATATTAAAGTAATAACATAGAGTATGTGTAACGCCCTGATTTTTTGTAACGAAAATTCCACAAGGTGCT
CATG

chr02 21,000,028 C G C
ACAACCACTCTACCTTCCTTTCA
AAAATGGTGCGTCTGCTGTG
23
20
23
59.69
108
CATAGTTTTGCAGTTTTCAAAAATATGGGTATAAGTACTTGCTTGCTCTCACTCTCACAAAGAATTCTTAGATTACAACTGATGACCATATGCTTGCCCT
TAGTGTAATGCTCCACTAATATCAGAATACTAAGGTTAGGATCAAATAGGTCTTTTCGGGTTGTAAAGTAGGCTAAAGGGACGAGTAGGACTATTTTGGC
CAGAATTGGTGACAATGCTCCCTAAGCGCTTTAATACACTATCTTATGTCATTTACACTAACTTTTAACAACCACTCTACCTTCCTTTCATCTACCAAC[
C/G]CCCTTTCACCCATTTTGTTACTCAATCAAAAACACTATGATGGGAATATACAACTCACAGCAGACGCACCATTTTCTTTTCTTTTCTTTTCTTTTT
TATTTTTTTTTATTTTTTTCATCTCTTTTTTTTTCTTTATTTTTTTTAAACATCCCTATGATAGCCACCCTCGATCACATATTTTCATGTACCAATAACT
AAACTTTGGGGCATCACTTTCACCATTTTTCTCTTATTTTGCCACACTCTTTACTCAACTTAATTCTACAATTTAAAGCGCTTAGGAGCTTTTGGATCAA
ATTA

chr02 32,500,350 A C A
GGAAGATAGTCCCTATTCAGCGT
AGGGAGCTAAATCTCTTGACA
23
21
23
56.07
147
ATTGAAAAATGCTCCTTCTAAATTCCAGAAAATAATGAATGACATTTTTAATCCATATATGAATTTCATTATTGTTTATATTGATGATATTCTGGTGTTT
TCAAAAACATTAGAATTACATTTTAAACATCTTGATATGTTTAAAAGGATTGTGATACAAAATGATTAAAATGAGTTTATTCCAGAAAAGTATTCGACTT
TAAGGTCACAATATTTGTCGAGGGAAGATAGTCCCTATTCAGCGTTTTATTGATTTTGCTGATAAATTTCCTGATGTTATCACTGATAAAACCCAATTG[
A/C]AAAGATTCTTAGGGAGTTTGAATTATATATCCCCATTTTATGAAAATTTGTCAAGAGATTTAGCTCCCTTATATGATAGATTAAAAAAGGGTTTTC
AAGGTCCCTGACTGATAGTTACACAAACCTTGTAAAACGCATTAAGCAACGTGTAAAATCTTTGCCTTGCTTAACTTTAGCTAACCCTGCTTGGCTAGAA
ATTATTGAAAGTAATGCCTCTAATGTTGGTTATGGAGGAATACTTAAACAAGTTAATCCCCATAATAATATTGAAGAATTGATACAATTTCATTTCGGGA
AATG

chr02 54,500,372 A A G
GTCAAAAACAAGTGAACTCCCCT
ACCTAAATCTGAGCCCAACTGT
23
22
23
59.36
149
CCAGTTAAAACAACAGAATTTCAAGACGTTCTCACAATCACTCAAATCCTAATCCAACTATTAAATCAATGAAATAATAATCATAGATCCCACAACCCTA
GTTGTGGGTTTTAGTTGCTCATAAGATAGAAAGAGATAACAAAGATTAAATTCATAACTTAAAGCAAGTGAACTTACAAAAGATGAAATTCAAAGTTGTT
TCTCCTTCAAGTACAATAAGAATTTCCCACAACTAAATCAAAGGATGGAAAATTGAATTCTAAGTTAAGAGAGTCAAAAACAAGTGAACTCCCCTTTAC[
A/G]AAGTTACAAATGTCAAAAGCTGCTTCTGAAGTTGTGAATGAAACCCTAAAAGATGCTATCTATACTAAAGCCTAATTAAGGTAATAAAATAATAAA
ATCACAGTTGGGCTCAGATTTAGGTGACGGCATATTGGTGTTGATCGTCAGGCTTCTGACGGCATCTCAGATATATCGTCAAAAGTCGTGCCTTCTTAAC
CTGTTCTGCGTTACTCTGACGATGTCCTCTGATAACTTACCAGAGAAGTGACGACATGTAGCAAATATCGTCATACCTTCAGCTTATTTTACCATGTTCT
ATCC

chr02 59,500,227 C A C
ACTAACAAGGTTGGGTCAGCC
CGTAGCCAGCGTAGGGTAAG
21
20
21
59.97
111
GATAATGGAGTGACTGATATCTGAGATTACTGATAACTGCATTACTGATATCTGGGTTTCTGTTTCTGATAGCCTTGATTCTGTAAAACTGAACTGAGGT
TTATACTGAGTCTAAAATTAAAACTGTAACTGAGGGAGTGTTCATCTAACCGACATACCCGAATTATAACCTAAGTTAGGGTCTAACATGTGACCCTAAT
TAGAAGGGTGTTAGCACCTCACCAAGGGATACTAACAAGGTTGGGTCAGCCCTAATTTTGTAGGAAGACTCATGAATTATATATATATGGTTGCGTCAA[
C/A]CCTATTCCAGCACGAGGATGTCTTACCCTACGCTGGCTACGTAGTTCTATAATGCAGAGACTACTACTAAGGGTCAAACGCTCTACTGGCATGAAT
GCACCCATCCCTAGATTCGCTCGGTAATGAATCCTACTCCCAACTGAATAGACAGTGATCACTAAATTGTACTAGGCGTGATTGAACTGATACTGATTAT
ATTGACTGACTAAACTGGACTAAGTTCACTGAGTTCTATAACTGACTGAGTACTATAGTTCATGATGTTACAGAGACTATTTTGTAGCTACTGTAATTTT
AGGT

chr02 60,030,900 C C A
TCGTCTATGGAGGAGCAGCT
AGCCTTCCACCCTATCCACT
20
20
20
59.96
112
TTTTGGATCTTCAACCTCGAAAGGAACGAAGTCCAATGCAAGTGCTTCAGAAGGAGGAGGCAGTGTGGCCGAATCACTGAAAAAAACTCTAGCTCTACTC
TAGCATTCCGGTTCCAAATACTCTGGAGCCAAGAGCGATGGTCGCTCAATAAATGCGTCATCTCCACTTACACCACATAAGCTAAGCACTTCAAAGATCA
ACTTATGTGATAATTCGTGTTACTCTCTGACATCTCCGGTAATCATGCAAGCAATGGTAACTGATGCCTCGTCTATGGAGGAGCAGCTTGCGAATCTGA[
C/A]AAAGGCAATCGAAGGCCTGACCAACTATGTTCAGAATCAAGAGGCTAGGATTGATAAGATAGTGGATAGGGTGGAAGGCTTGATAGACGAAGAATC
TAGTCATGCACTAAAAAAAGCTCCAGAAGTTCATGAGATAGAAAATCCTGTGAAACAAAAACCATCGACTAAAGAGGTGCAAGTTTCTGCTAAGGGAATG
ATCCCGATTGTGCAATTGAGGGAATTTATTGAAGGGACCCTCAAAGACAAGTATGATATTGTCACCAAGTCTTCCCTTGCATATGTCAAGTCTTACACTG
CAAG

chr02 67,502,803 C C T
TCATGGGTCTAGGCCACCTT
ACGAACAACGGTTGTATTCCA
20
21
20
58.16
143
CCTATGCTGCATGAACACTCAACTAAGCCCTACTCAAGATGCATCGCAGTAAACCACAAATCCATCATTGCCTTTCGGTAAAGTCAGAATTGGAGATGAA
GTTAACTAATCCTTCAATTTCTCTAAAATCTCTTCACAAGCATATGACCAAGAAAACTTGACCTTCTTCTAAGTTAACTTAGTCAAAGGAGCAACTATTG
ATGAAAATCTTTCCACAAACCGCCTATAATACCCATCTAAACCCAAGAAGCTCCGAATGTCAGATGGATTCATGGGTCTAGGCCACCTTTTCACCACAA[
C/T]ATCCTTTTATGGATCCACTATGATCCATCCACTAGAAATAACATGCCCAAGAAAGTTATAGCGTTTAACCAAAACTCACTATTAGAGAACTTGGAA
TACAACCGTTGTTCGTTTAAGGTCTATAACACCATACGAAAGTGATTAAAATGATCCACCTCTTTTTGAATAGACCAAAATGTCATCAATAAACACAATA
AAGAGGAGATCTAAATACTGACAAAAAACTCTATTCATCAGATCCATAAATAGTGTTGGAGCATTAGTCAATCCAAATGACATCATTGAAAATTTAAAGT
GCCT

chr02 83,504,407 C A C
TCTTTCTGGGCTTAGGCACG
ACTTCCCCCGTCTATCTTATGAGA
20
24
20
60.14
147
TGGAAAATTTTAATTACATTTTCTATGAGAAATTACAATGTACTTTGAAATGAAAAATAAAAAGCATTAACTTTCAATTCAAGATGCAAGTTGTTCTTTT
GTGCCCACTTTTCTTACATAATAAGTGCTTGTTATTTTTTCTTGTACTCCTAGAGGTTCCAAGACACTAAGAAGATGTTGCACTTTCTTCTTTCTGGGCT
TAGGCACGTAATGAAGTAGAAGCAGCTTAATCTCTTTTATATGATTGAGAATAATCCATTCAACCTCAAGAGTAACTATATTGGAAGTGTCACTATATG[
C/A]ACTTAAATAATTCTCATAAGATAGACGGGGGAAGTATATTCATGAATGTTTTTTAAAAATCATCTTTGAACTTCAACCTCAAGGCTGCCATAGCAT
GATCACAAAGAATTTTCATCAAGTAAAACTTTCTACAAGAACATGTATATTCTAGTAGATTGACCTTGACAGTAACACCACTTCATATTACCGTGTACGT
GTACGCGTCCATATTTATGTTACTCATATGTAACTTATCCCCTGCGTCTATATTTTTCTGTATGATCTTTTCAACCATCGGAACAAATTTACTAGTCAAT
TTTA

chr02 85,000,176 G G A
AAGAGATGAGCCTAAGAGAGT
TCTACCAATTCCACCTCCTAGG
21
22
21
58.35
150
AATCTACTACCAAGGCAAAAAAAAATAATTAAAGTTGTAGAGGTGAAAGGAGATGTAGAAAATGAGTCTGATATTGTCATTGCTTCTAATAAGAAAAGGT
TAGATGCTCATGATAATGAAAGGACCAGGTCCTCTGATCCTAAGTTTGAGAGTCATGGTGTAAGCAAGAAGAAACACATTGCTGTAAAAAGAAAAAAGGT
ATATAAGGGACCCAAATCCAAGAAAAGATAAATTAATGAAAAGAAAGAGCTAAGAGATGAGCCTAAGAGAGTAAAAAGATAGGAAAAAAAGTAAAATTT[
G/A]TCTCCAAAAGAAAGATTGAAAGACGAAGACATAAAAAGTATTGTCAGGAAGGATATTTGATTCCAAAATCTATGAGAAACCTAGGAGGTGGAATTG
GTAGAATATGTCAAGCATCAAGGAGGATGCATTTATTCGAGGAAGCAGCACCAGTGGTTTTTTAAAACAATGTGAGAGAATTTTATTATTCAATAGATTT
CTCAAAAGATGGGTTGAGTCTATCTATACAGGTGCAAGGAAAAGAAATATGGCTGGATAAGAAACCTTGGGAGGAATTTTAGATGTTTCTGTTATAGGGG
TGAT

chr02 104,227,021 G G C
ACATAGATCCGCACCCCCTA
AGTCCCTTGAGTTATATTTGGAGA
20
24
20
56.86
138
AAATAACATTGAAAATCTAGAATTAGATATACATTACAGTACAATTAGGATAAATTATTATACCGAAATCTGTAACTCTGCAATTACTACAGGATAAAAT
AATAACTACACAAATTAATGAATACATCTTACAAAAAGAATAAATCATTAAAAGATATTGAAACAAAATTTAAGAAATATCCACGCACAAAGAAAAATAG
ATTCATTATACATATAATAAATCTATTTCATAAGTTAGTTATTCACATAGATCCGCACCCCCTACTATATAATAGATCTATTTCATAAGTTAGTTATCC[
G/C]CATAGATAAAACCAAAAACTTAATGTCTATATATTTTGACTTGACGAACTTTAATTGTTCTCCAAATATAACTCAAGGGACTTATTATCACAATAA
ATTTTTAATGGTCTTTCTATGCCACCAACTATTTACATTTTAGTGATAAAATTTTTTTAGCCATATTTCTTGATTTGATGCTTCATAGCAGGCCACAAAT
TTGGCTTACATTATAAAAGAACCTATTAATGTTTGCTTCACACTTGTTCAAGGAAAAGGTCCTTCAGCCAACATGAAAACATAACCTCATATAGATCTCC
TACT

chr02 108,000,522 C C T
GCCAGAGGACAACAATGTTCG
ACCAAAACAAACATGCATACCACA
21
24
21
60.14
133
GAGGAGGAATGTCTCAAAAGAGATGATCCAACTGCTAATAGCCCTTCTATCGAAGAGTTGGTCAAAACCTACAGCATTAATCGTTATCCTGTGAGAATGC
AGTATGATGGTGCCACAGATTTAACGGGTGATTTCATCGTTAAGTCAACCATGGAAAAATCTTTTGACGCCTTCAGAAAAATACTACGAGAACAAAAATT
GGATGCTTATTTTAGGAAAAGCTGCTTTGGGCAATATCTTATTTGCCAGAGGACAACAATGTTCGTTTCCAAATGAAAATGGTATACGATCTTCTCAAG[
C/T]GTAGGTTTATGTATGAAAACAAAGATAAGATGGATGAAGTGTGGATAAATTAATGTGGTATGCATGTTTGTTTTGGTTAGAAGGAGTTTTCCATAG
TTATCGGACTAAAATGTTATCCTCCTTCTCCTTCTCAAGTTATATCTACTCTGACCTAAAAAAAAACACCCCACACACTCAAAAAAGGCAAAGGCAAGTC
GAGTGATAGTGATTACCTGGTATCGATTGTTGATCCAAGCATAAAAAAAATTAATAGAAGCGTTGTAAGGTAAAGGACTCTCAAAGAAGAACAAGCAATC
ATTG

chr02 112,000,150 C A C
TGGGTAGAGACTGAGAAAGGC
TGTGGTGACTGGTACATTACA
21
21
21
56.59
150
CATTTGGAAACTGAAACTGGACCACTCTGTTTCTACAGTCGACTGTGGCATAGCAGGAATGAACCCAATCCATACCGAGAATGATGTCAAAATTAGTCAT
CTCTAATTTTACTAAGTCTGCTGATGTGAATTTCTAAAATATCACAACTGGATAGTTTCTGTATACCTGCCTGGCTATAATGGTTTTACCCACTGGGTAG
AGACTGAGAAAGGCTCTACTAGAATTTTAGGACTGACTCCAAAATCAACTACTATATAAGGAGTAATAAAAGACAAAGAAGCTTCTAGATCTATCAAAG[
C/A]ATAAACATGCAAGTGAAAGATATGTAATGTACCAGTCACCACATCAAGAGAATTTTCCTGATCCTATCGAAACTAGAGGGCATAATGTCTATTTGG
GCACTACCCACTGGTTGCACTAGAAGTGGTACCCTACTGATTTGGGAGACCAAATTGAATTAAGAAACGGTTTTGCTAAACTAGAAATCCTGACTAGGGA
CAATCTCTAACTCTTTGGCCTAGCTTGCCACATCCGAAGCACACATCACTACCAGCTCTGCAAATAACCTTGTGGTTCTTATCATAAGTCTGACAATGAG
GATA

chr02 138,011,439 C T C
TCAGTTCCATTTTTCTGACTCCA
TCATACCCCTCTTTTGAAATCA
23
22
23
55.05
145
AAGGAAATAAATTTTTGCCCCAATTTTATTTCATACTGGGTAAATTGAATTTTTACTTGGTTAGATCGAACCCCAGAATAGGGCTGCCTACATATCTTGT
CATAGCAAGAATCAGGTTAAACGTAGTTCAGACAAGTCATTCTCTTTTTTTTTTTTTGAAATGAACCTGGGCTCTCATTTTTTCTTTTCTTTGATTCTTC
TCTTTTTGGTTTTTTTTTTTCAGTTCCATTTTTCTGACTCCATTTTCTTCTTGACACACATTTTTTTTTTGACTTCATTTTTTCTTGACATTTTTCTGA[
C/T]TCCATTTTTCTTGACACCTTTTTTTTTTTTCAAACTCTATTTTGATTTCAAAAGAGGGGTATGAAATAAAATAAAACTAAAGCTCAAAAGGGGTCA
CAAAGGATGACACTACATTTGGATAGCAGAATGAAATGCCTTCGTCATATCAATCCTTAAAAATGGAAACATTTAACATGCAATCTGTGAGTGAACATAA
AGATCATGTATATTTTTTTTCAATATTGACCTTGACTGAATATGTATGTCACTACTTCTCATGCACTTGTCAAACAGAAAGGTCCAATTATATTCACATT
CCTC

chr02 163,513,506 A A G
TCTCGATTCCATACCTTATTCTCA
TGTGTGATCGCAAATGATTGA
24
21
24
56.53
142
GGATAATTTTTTTTCGTTAAATAGCACTTGTTTTGAAACGAGAGAGCACTTAATTTCTTAAAAAAACATGTAAAATAGAAACACGGCGAAGAATATATAT
GTAATGATTATGATGAATATCGACTCTTGAGAAGTTCAAATTGGCTGCTAAAACCAATAACGTAACATTGTTAATCTTCCTAGGATTTTTGTGGAACAAA
TCAAATTATTGGAATAAGAGTTCGAGTTAATCAATAGATCTCGATTCCATACCTTATTCTCATTGATATTTAATTTGCATTAATAGTAAATAAAATATT[
A/G]CTAGTATAAGAATGAGTAGTACTTACTTTAAAAACAAAGCTACAGTTCTACTTATAGATTCAATCATTTGCGATCACACAATAAGTACATGCACCA
AACTTGCATTTCTTATTCTTTTTGTTTGTTTCAAAAGGTGTGACCGAGATAATATTGGCAAATTAAACAAGTGTGAATAAGCTTGATTCAACTATTTTTT
ACGTTTTACTGACACTTAAATTAATTTAATGTATAACTATTGATGAAAATTTCTCTATTAGAAAACAACAATGTATAATTCGATCAATTATTGGATTGAT
AAAC

chr02 165,500,040 G G C
CCTAGTGGAACCTGCTATTCAGT
CCATGACTGGCCACAAAAGA
23
20
23
58.38
140
TCTCCTAAATTTTGGTTTATTTTGTTCAGATACATTTCATCCCTACACAGTTACGTACAGTTTTAATTTGTATCAAAAAAGAAAGAAAAACTTTGGTTTT
GAGTCTGGCATGATCAAATGGTTACCTGTTCTTGAAAATTAAATCCTTGTCAATCACTTCTCCTTCACAAGATATAAGCGAGATCATCATCCACCAACTC
AAGCATGATGCTCTTCCTTTCCTAGTGGAACCTGCTATTCAGTATCAAGTGAAAGAGTTTTTGTACCGAGCATTTGCTTAAACGTAACTAATGATTCTA[
G/C]CTATTGCCTTTCTTATGTTTGTTTCTCTCTTTTAGACTTTTCTTTTGTGGCCAGTCATGGTGGTCCTAATACATTTTTTTGAACTATTTTGATATC
TAAATGGACCGTACAATGATGTGTGCCAATTCTCAATGTTTTAATGAACTAATGCAGTATGTCAAGTGTGGCTTTGCGGGTGAGAATTTTCCCACATCTG
TATTCCCTTGTGTTGTGGGGAGGCCAATGCTAAGATATGAAGAATCCCTCATGGAACAAGACTTGAAGGTAATCATCTGTCTCTTTATTCTTACCCTTCA
ATGA

chr03 16,001,363 C C T
TATTTCGTGGCTCAGCTGCA
TGCTTCATACAGCTCAGCTCC
20
21
20
60.13
144
TAGACATCTATTCCGTTTTTTGGATTACGCGGGCCAGGAATAACATAATTCAGAAGTAAATAGGGACTAGTCATCAATATTTCAAGAGGAAGATTATAAG
GAGTGATAAATACAGGCCAACATGAATATGGCGCACCACCAACTAAAAAGGAGCGAACCCATCCGCACATAATTCCAATCTAATATTTCGTGGCTCAGCT
GCAAAATTTGGATAAGTTGTATTAAAATGCTTCCAAGCTTCTCCATCAGATGGATGACACATAACACCAAGGGGGGATTTTATTTTCACTATGCCATCT[
C/T]ATATGAGGAGCTGAGCTGTATGAAGCATACAACCTCTTCAACCTTGGTATAAGAGGTAAATAATGCATTGCCTTAATAGCAATTTGCTTCCCAATA
GAACCACACTTATATCTAGGGTGCTAACAAAACTTATAGAACTCTAGGTCAGCATCTCCCTTAAATTATAACATGCAGCCATTTTCACAATAATTAATTC
TAACCAAGGAGAGACCAAACTTTGACAGCAATCTTTTTGCCTTATAGAAAGAATCAGGTATCTCCATGCCGGGGTGAACTAACTCTTTAATAAAGTCTAT
AATT

chr03 32,000,059 C C T
CACTCAACTGAGGCCTGAGG
TCAGTTCCAGTACCCATGCT
20
20
20
58.34
131
CAAAAATAAAATCATCAAAGTTTGAGAGCTTTATAAATGAATAAGTCCCAACACTAGTGAAATTTTTTAAGTCTTGGACCCCTTTTAACCTGTAATAGTA
AGCTAATATGTTTTTTGCCAACAAAAAATATTTACTCTCTCCCATCTAGCAACTGCTCATCACTACTATTATTTAATAAGGGGAGGTCACTGAAAGGTTA
GGACATGAGGACTTGAAGCATGAAAGAATAAATTTGACACTCAACTGAGGCCTGAGGAATAGAGTGTCAATGACATGAATTCATTAAAGAGGTCTGAAC[
C/T]GAGGACATGCATGGCATAAGTCTAAATTTTGCTGATCATTAAAAGTATAGCATGGGTACTGGAACTGAACACACTGTAAAACATAAATACATGAGT
CATGAGCTATATGATCTGATTTTTTTTGGAGTTTCTAAATTTGTGGAACATGGTTCTTACTGCTGAGAAAACTGGAACTCTTTATACTAGGGACTGGAAG
CATATGTGATTCTTTATGATGTGAATGACATGAACTATGATTATGGAACTGACATGTAAGGAATGAGTAGATATCGTGATAACTGAGAAATCTTGCATTG
AAGT

chr03 33,551,207 G G T
CATTCTGGTTTGGCTGTGAGC
GGCCTTGGGTTAGCTTAGGG
21
20
21
60.11
118
ACTATTTACTATGTGTAACCATGTGGGGTCTTATATGATACTGTTATCCTAGTACATATGTATATTTGGTTGTTTTCTTCTTGGTGAAAATTGCCTAAGT
TAGGATTTATGTGGTATCAATGGCATGTTACTTGCAAATTTTACTCTAGTGGTGCATGGACTATATTGGATCAATGATGGTTGTCTTATTGAGTGGATTT
CTAGACCACGTGCTTGTGTATTAGTTGGATTTGAAATTCTCATTCTGGTTTGGCTGTGAGCATTACATCCTTATATCATATATTGTCATGACCTATATT[
G/T]CCCTCTATTCGTAACACAGTGCTTAGAGTCACAAGTGACCCTAAGCTAACCCAAGGCCTATCATAGCATTAAGAATACTAAAAGAAATAGACAAAT
ATTGGGTTGAAGCTAATTTAAAAGTAAATTGATAATAAATGGTCATGGAATAAAAGTTGATACCATCTGAAATACTCTACAAACTAAAAAACATGTCTAA
CTATCTGAAATCCTCTAAATCATAATGAGTTATTGGGATAGGTCTCCAACTAACTCTAATTGACTGAAATAAAATAAAATGCTGAAATAAATAAATGATA
ACTA

chr03 78,157,723 A A G
TCAAGCCTATCTGTTGGGTGAC
GTCATCGGTCTCAGCAAGGA
22
20
22
59.47
125
ACATACTTACTTAACTGCTATTGAACTCATGGAGATACTAACTACTTGACTTTGAACTCTGACAACATGAGTTCCATGATACTGAGATATTGAATGACTG
ATAACATGGATGACTGTATCTAATAGTCCTAAGTTTGGGGAAAACTATCTGAGTTCCAAACTGTATCTGAACATCTAGTATAAGATCAGTCCTACCTAAT
GAGTGATCTCTGAAACAGATAATGAGAATACTCGACTGAATCTGAGATTGAGATCAAGCCTATCTGTTGGGTGACCTCTAGATCTAATAATAAGCATCT[
A/G]AATATGGGATCAACCCTATCTGATAGGATGGTCCAGGAATCAATGGAACAATCTAAGTTCCTTGCTGAGACCGATGACTGTATCTGATAGTCCTGA
TTCCTGATTTCTGCTCTAAAGAGTGATACTGAATTTGTAACTATAACTGTGACTGTGGGAGGTAGTAACCTAACCGACATGCCTTGATACTGTACTGGTG
GGGTTCAATCTTTTCCTTGATTGGAAGGATGTCAATACCGTGCCACGGATAGAGACCTCTACTATGGTCAAGCCTCTCTGAGGGGTGACCCTGAACAAGA
AATC

chr03 82,395,110 C C T
TGAGTTAAAATCAAGTTGGGGT
AGCCCTAAAAAGAACCCACA
22
20
22
56.94
127
AGAACCTCTCTTTATTTTCTCTTGCTCGTGTAACCACATTGAAGGATTCCATCAGGTATGCTTGAAACCTAGACTTTCTTTTCAAGTGGTAAGTGATAAA
TTGATAAAAACCCAAGTTCCTAAGAAGCTTGAACCAAGTTTAGCTTGTAAAAATGGCTAAAAATTGGAAATAGGGTTTGTTGTGCAAGCTTAAGGTTTAA
AAGTTTAGCTCAAAAATAAAAATCAAGTGGATTTTAAGAAAAAAAATGGGAACAAAAATTGAGTTAAAATCAAGTTGGGGTTATGTTTATAGCTGACAA[
C/T]ATTCGTGATAAGCTATCACAAATGTGATGGCTTGTCAGAAATATTGTCAGAAGTTGATAAGAATTTTGTGGGTTCTTTTTAGGGCTAACGACATTC
ATCATAAGCTATCATAACTATGAGGGCTTATCAGAAATGTCGTCACACCTGGGACCTAAAGTATTACTAAACCCTTTCAAGTGGTATGGAATTGCAATGA
TCGATATGTTTGTGTTTGTACTCTTGAGGGTCAACTAATGGTTTTTCTCTTGCTACAGGTCTTGAAATGGCTATCAAAGGAAGGAACTCAAAATCCACAA
AGAA

chr03 84,504,028 C A C
GGGACACTAGGAAGGTCATCG
TCCAACTTATAGGGTCCTTCT
21
21
21
55.08
86
CCCCTTATAAAATATACATATATGGTCCACCCCATAAGGATTAACCCTTATTTCCTTATTCACTCACTTATAAGATATATATACCAAAAAGAAACCATCC
CTCTTATGAACGAAAGAATGGAAGCACCCTATGGAGAAACACTAGGGTGAATAAACCCTTATCGAAAAGATACTTTGGTTGTTCCTTAAGCTCCTTCAAA
TAGACTATAGTCATTCTATAAAGAGGGAACAGAAACATAATCAATCCAAACTCAATTTTTCTATTGGGACACTAGGAAGGTCATCGAGAAAGACATCAA[
C/A]AATTTCATCCACCAGTAGGATAGAATTCAAAGAAGGACCCTATAAGTTGGAATCTTTATCCCAAACTAGATGATAGTGATACACTTTTGAGATTAA
CCTCCTATCTCTAAGATATAATATGCACTTTATTTTAGGAGATAGTGACCCACTGTCTCACTCAATAATTGGCTTTGTAGAAAATTTAATGATGACCTTA
GAGTCCCAACAGTCTAGAGACACATAGCACGAGTGCAACCAATCCACCCCTATTATTACATTGAAATAAACCATATCTAATTCAAATAGATCTACCAAAG
TCTT

chr03 102,004,825 T C T
AGCTCAAATTGGTTGGGAGA
AAACACTCGGGGCATGTTCT
20
20
20
59.89
116
TGAGGAAAGAATCCCATAAAGTGTAATGATAATGTTGCCCTGCATTCACCCAAGTTTTTCCTCAATTGTTTAGAAAGAGGCAAAAGATAAAAAATTCTTT
CAAAATGTCATTGGCAAGAAATGAAATGATAGTTTTTTATTGAAAAAAAGAGATATCAAGGATGTTTTTGAGATTTATTTTGAGTGTGACCATTAAATTA
AATTTTTGCCTCTCTTTACAAGGACGAGTCATGACTCACAGTAATTTATTAAGCTCAAATTGGTTGGGAGATTAACCTTTTTGCTCTATGAGTACAATG[
T/C]CATATGTGGTGAGATTTTTGTATAATTATTGGACATATGTTTAGTATAGAACATGCCCCGAGTGTTTTGAAAGTTAAATTCTAGACAATCTTGGTT
TGGAGAATGACCCGAGGCTATTTTTTAACTCTTCACATAGCCAAATTCCCACCATAACATTTTTCCCTAGTTAACCCCTTTGAGCCTTTTTACCCATTTT
TATTTCTCTGTCTAATGATAACCTTGCTAAAATACTTAAGCCCTTTTTAAAATCATCCTTTTGACACTTAACCTCCTTTGATGCATTGCATGATTCTAAG
AAAT

chr03 120,000,394 G G A
GAACACATCAGCGTGCACTC
ACAGAGAGGTAAGGTCATAGCCT
20
23
20
60.05
148
AGATGATGAACTTCCTGAACTAACTTTTTCTTATCATATTCCACGTGAGCCACACTACCCATAGACATCCTACTGAGAGCATCATCCACTACGTTGCCTG
GATTATACAGAATGCTTATGTCATAGTCTTTCAACAACTCCAACCACCTTATTTGATAGAGGTTTAGGTCTTTTTGAGAGAACACATACTAGCGGCTCTT
ATGGTCAGTGAACACATCAGCGTGCACTCTATACAAATAGTGCCTCTAAATTTTTAAGCCAAATACTATAGCTGCTAATTCAAGATCATGAGCGGGATA[
G/A]TTCTTTTCATGGGACTTAAGCAGTCTAGAGGAATAGGCTATGACCTTACCTCTCTGTATCAAAACACACCCCAAAACAACTCTGGAAGCATTACAA
TATACCACAAATCCGTCTGAACCATCTGGTAAAGTCAAAACTGGGGCTGTAGTAAGTCAAGTCTTCAACTCCTAAAAGCTCTTCTCATAAGAATCTGACC
ACTGGAATTTGACTTTATTTTGAGTCAACCTGGATATAGGGGATTCAATAGAGAAAATTCCCTTAACAAACCATCGATAATAGCCATCCAAGCCCAAGAA
GTTC

chr03 125,001,502 T T G
GCCTAGCGAAAAGATGCAGC
AGAGGCTACAAACCCTAGAACA
20
22
20
58.48
145
ATATTTTACAGGCATAAAGATGACATGATAGAAAGATATGGATTGGGGATGAAAATGTTCAAATAGAAGCAAAAAAGTGCAACTAAAGACCTAGAGTAGA
CATGACCTCAGTTACCGTAATTACGGTCAGTCAATAAGGTCAACTACCACAGTCATGTGAGCTAATTACGATTATGGTAGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGTCATGACCAAGCCTATGCAATCATGGCCTAGCGAAAAGATGCAGCCTAAGGGAAAAAATAGAAATGCACGTAGCTGATCCCAAAT[
T/G]TTACCAAAATAATACTCAAATTCTATTATTCATCATATTCTATCTTCCCCAATTTTGAACATTGTTCTAGGGTTTGTAGCCTCTATTTTTGGAGAA
GGAAATATTGTATAAATTTTGGGTGAAGAATATTTTGGAGTCACTTCCAAGTGAATAATTAGTGAACTCTCATTGAAGATTTGTTGGATCTCATAGTTTA
AATTAACATTCACTTAGATTTTTTCAAATCATATCAATGGAGATTTTGGGTAAAATCTTTACCTATTTATCTTATGAGTAACTAGTTTTTCCTCTTGGTA
TTAT

chr03 166,007,091 C C A
GGTCTGTGGTTGGATCTTTAGC
AAGCCTTGTACCCTTTCCCG
22
20
22
59.96
148
TAAAGTTTCTTTGACATGCCTCCTACTATAGCCAAACTAAACCGAAGAAAAGTATATGAAATAAGGAAACAAAATCATGATATGGGGTCTTCCAAAGTAT
CAAATCTCACCACTTTAGTCTGACTCATGAGCTGTCCCACAATCACTTAGTCATTATACATTAGGAGTAGAAATATTACGACATCTTGCATCGCATGGGG
ATACAACATTTGAAGATGGTCTGTGGTTGGATCTTTAGCATGTAAGTAAAGGATAAAGATAATATAATTCCATGAATGATAATTTAAAACTAGTCCAAT[
C/A]CCATGCATACCATCAAGTTCAAATACACATATATATGTTACATGACGGGAAAGGGTACAAGGCTTAACATGAATGTTTAACATTCTTAAACTGGGT
TGTGTAGGTTAACTGTCATAATAATAGTACCGATAGGATGTATGGACCCTAGATCGTACCCCTTGGTTGGGCCCCAAGGCGTGTAGCCACACAACTCAGA
GAAAGATCATATATATATATATATATATATATATGCACATGGGCGACTCGATTCCTCCAACATATACCAAGGTGAATTAAGCACCCAATCATGAATGTGA
TATA

chr03 178,001,241 G G A
ACTTTCTTTACAAAGGCATGAGT
TCGTTCAAGATTCGTGCTTT
23
20
23
56.01
150
GCTCCTACATCCAACTTCAAGAACCTCCAAAGTTCACCATTAATTCTGCAAATTTATTCAAGATTCCATGTTCCTAGTTCAAGAACTCCAAGAACCATCA
TTCGAAGTCACGATCAACATCTCAAAAATGAGTATCGACCTAAAGTTTATCATTCAAGGTATGTGGGGGTTTTAAACAAGAACTCTCTTTCGTTCTTGTG
CCCAAAAGTAACTTTCTTTACAAAGGCATGAGTTTTATTTGATTTTTATGAATTTGAAGTATGAACCCATATCTTATGATGATTATTATGAATCTAGAT[
G/A]TTTATGATTTTGAAAGATGAATTTACATGTTTGGAGAAATAAAGCACGAATCTTGAACGATATTTATCATGATTTTGATACTTGGGTCGTGAATCC
CTATTGGAAATTGTGTTTTTTCGAGAAAGTGTGTGTTATAAGTACGTTGATGTTGAATATTTAAGATATTTTGAATGATTTGACCTTTTGGTCTTAATGG
AGTTATTTTGAACTCGAGTGTGAAAGAAATCCACAACGTGGTTGATTTTGATAGATGGGAAGAATGATGGCTCCCGATGTATATTTATATATTACTGAAA
TTGT

chr03 191,000,867 T T G
GCACAACAAATTTGGCCGGA
TGAGGATTTTGATGGCACCGA
20
21
20
60
103
GTTATCGTCGTGGTACGACGTCTTCTTTCTTTCTTAAGTTGGGTCATCACGGGCCCCCTTATTTACTTTCTCAACTTTAACATCGATTACCTATACCATT
TGAAGCTCCATGGGTTGTTTCTTTATTTTGCACACCCGAAAGGACACTTCACCATTATGAACTCTAAACTTCATTTCCCCAAGATCCAAATCAAAAATGG
CTCTCAAGAAAAGGTCGACCAAGAATGATGGGCACCTCTTTGTCCATTTTACAATGTTGCACAACAAATTTGGCCGGAAGGATGAATCAATTTACTTTC[
T/G]CCAACATGTCAAACACAACACCAATTAATTTCTTGATAGATCGGTGCCATCAAAATCCTCATTGACATTGGAATAGTAGTTCCTGAGCCAAGACTC
TTATATATTATGAAGGGCATGAGATTTATACTCACACCAAGGTCATATAATGCCTTCTCAAACTTATGTGCCCCCATAGTGCATGCAATTGTAAAAGCTC
CCAAATCTTCCTTCTTTTCTGCTATCGCACTAGCCATGATAGTGCTATACCCATGAGTAAATTCAATGGTCTCACATTCAACAAGTCTCTTCTTGGACAT
CAAT

chr03 218,000,200 A T A
TGTGTGTCACCCTTATGCACA
CCGACCATGGTTGTGCGTTA
21
20
21
60.95
146
AGAAAGCAGGCTGCAAGAGTCAGACCATTGATAAAGGAGTCTGAAATGATTGATATCTTTCTAAAGGCACAAGAACCTAATTATTTCCATTATTTGATTT
CTACTATTTGAAGCACATTTTCTGAAGTCATTAAGTCCAAGAAGATTATCAGCCAGGATGCTTTGAAAGCAACAACACAGGCAATTCAAAGTAGTTCAGG
ATGTTTTGGTTGAAAGAAAAGAAAATAGGATGTATCTACTATTTTGCCAGGCCCACGATAAAATTGGAGAGGTGTGTGTCACCCTTATGCACAATCTCA[
A/T]TCCCATATGTATGTCCAAGACCCATATAACCATCCATGATAATATGTTCCTCCACAAAATTTATTATATTCTATTCCATCTCCTAAGTATTCTACC
TATAACGCACAACCATGGTCGGGTTTCTTCTTACCCGCAATGACGTGCACTAGTCATCCAAAATTATTCACCAATCCCACAAGTTCAAAGAGGCCCTCCT
AGGTCTAATTTTCAGCCTAGAGCAGACTACAAGAAGAATAACATGGGCAAAGATAATTTCACTCTTATTGGAATATCTTATGACAGCTTATTTTAAAGGC
TAAG

chr03 225,000,018 T C T
TCGCATTGAGCCTCAGAAGT
AGATCATGTTCGGAGTTCCA
20
20
20
56.25
119
TTGAATTTGAAGCTCTTATGAAATCCCTAGACTTGTTCTTGAGAGTATTTGAGAGAAACAACAATATTTTAGTGAAATAATGGCTGAATCTCGTGTTTTT
GGACTTATATAGGGGTGGAAAATTGACACTTGAGGACACGGTCATTTAATGACTAAAAACTGGGTGTCGACACTATAAGCGACGCGGCGTGTTGATGGCT
ACAATACGATACTCGATGCGTCACACTATGATCGCATTGAGCCTCAGAAGTTTTTGCTCTGGCAGTCTGCACAAATGTTGACCAACGTGATTGGTGATG[
T/C]GGCACAGAAAATTGCATTGGTCCACTATTTTGGAACTCCGAACATGATCTAAACATGTTCTAAAAAATCCAAAACTTGTTCGGGAACACCTATTGA
TCTTCCTAATCATGAATTTATAAAAATATAGATCCTTTAAGGATGTTAAGGTCGCTTAATGAGATTGACAACTTTCGAAGGCTAAAATAAACTAAGTCTA
GAAGCTTAGCTAGGATTTTCTAAGTATGGGACCTCTTGACAAGCTTGAAGGATTGAATTTAGCTTAAGAAATTTACGGGGTCTTACATCTTATACATTGA
TCCT

chr03 235,007,558 G A G
AGTTTCGGGATGAGGTTTTATAT
ACATGCGGGGACTTCTTAGG
23
20
23
59.46
150
GTGTAAGAGTATATATATATATCAACATCATACAGTTATCATTATGTAAATATAACTATATATGTAAACATATACATATATATACATATATATACATACA
TAAAGTTATACATTTATTCAATTGGGTCAGCATATAAGTTTTTTATGTGTTTATGATATACAATTGTATACAGTTAGTTTCGGGATGAGGTTTTATATAC
ATTTTTAATTTTTTTTGTTGATCATTTATATTTGTTTTTTTTGTTGATCATTTGTATTTTTTTTTTTTTGTTTAACAGGATAGTAGTTTTGTCATCATA[
G/A]ATTTTCCTAAGAAGTCCCCGCATGTAGTGTGTTATGTGGAGCCTTCATTGTTGCATATGCGGAGTATCTTAGCCATGGAAAGATATACCACCTGAA
TATTTTGATGCAGAAGCTTTTCGTACCCGTTATGCTACTCTTCTATGGCAGCATGGGACTCAGAAGAATGAGATTGGCGCAGTTAGTGATGATGAGAGTC
CGAATAGGCTAGTGAGGCCTCAATTTGAATGTGAGAGTAGTGACATGATAATTATCCCTTAGATAGTACATATGTTCCTCCATTTTGTTGGTTTTAGGTG
AAAA

chr04 27,000,943 G T G
ATTCGCCTCACTCTTGGAGC
TCACGGAGTTGATGAACGGG
20
20
20
60.04
98
AACAACACAACTATAAGGAGGGTTAAAATTGTAAAATCACACAAAATCACAAATTTCATCAAATTTCAGGTTGTTATAAGTAACCTGCCAAGCCAATAAC
ACTCCAAATCTCATGGTTGAAGTAGGCCTAGCCCAATATCTAATAAGGTGACAGACTCCAACAAAAACTCAAACTTGGAGAACTTAGCATACACCTGCTC
ATCTCTCAATATCTAAAGTATAATCCACATATGTTTCTCATGATTCGCCTCACTCTTGGAGCAAACCAAGATATAATCTATAAATATAATAATAAAGGA[
G/T]TTGAGATACGACTAAAATACCCCGTTCATCAACTCCGTGAATGTGGATGGGGCATTGGTCAATCCAAAGGACATAATCAAGAACTCATAATGACCA
TATCGAGTTCAAAAAGCTATATTAGGAATATCCGAAGCGCTAATCCTCAACTGGTGATACGCGGATCTCAAATCAATCTTTGAAAACACCAAAGCACCCT
AAAGCGATCAAACAAATCATCAATACAAGGAAGAGAATACTTATTCTTAACCGCCAGTTTGTTCAATTGACAATAATCAATGCACATATGCATAGACCCA
GCCT

chr04 31,501,078 G T G
GCAAGCCTCTGATCTTCTCCA
AAGTCCACTGCTGTTGACCT
21
20
21
59.16
149
ACATGTTGAGTGTGCATCAACACATTTTGACCTAAAACAAACACAGCAACCCTTCATGTATCCTTTAAGGCTTCTAAAGAAAGTTTTTTGAAGGCCTTCT
TCAGTGCCACAACTTTGAAGGTAGTGTTCCTGATCGAGCTCACAAGAGACCAGGAACTCTATACCAAATTCAAAGACGACAAGGAAAAAATTAAAGACTG
AATCGGCAAGCTAGAGAGAAGCTTGAAAATTATCGGGATTCACATACTACAGCAAGCCTCTGATCTTCTCCAAGGAATGTTGAAAGCATGCTAAGGCAA[
G/T]AAAACACAATCAATTAATCCATATTGCTAAGGAAGTAATGATACTCAATTTGCCTTTCAATCTCGTTTGTGGTTCCGATTAGGTCAACAGCAGTGG
ACTTAATCGGAACCACAAACAAGAAGGCATGGTAAGCAATTTAAAATTCAGAAATTTTTGCCTTCACTTAGATTATTTACTTTAACTGCAGTTGCTATTA
GCGGAAGTTTTCTAGACTTACTGTACATCATTTCAACCTTCGATGCCCGTAAGGCTGCTTTCTTGGTCTTCTGTTATTTTTTATCTATGTGATAATCCTG
ACCA

chr04 33,002,242 A A T
ATCTACAACTGGCTTTGTCAT
GGCACAATGTCCGACCCATA
21
20
21
60.11
91
ATAGTGCACTGAGATTCCACAACCTTAACCTTCTCAGCCTTGCCTGAAAGCATGTGCTTGGTCAGCAAGTCCATCTGAGTCTTTAAGTGGGCCTTGTCTT
GGTCTCGCTTCTCATCTCTTTAGTATTGCTCCACATTCATACCACTAGAAACAGTCAGGCTAGCTACCACAGAATCCCTGGTATGCCAAGCCCGACTCTA
TTTGGTCATTCTATTCAGTATGTCTGAAGCATCTTGAAAAGAAAGGTCAATTAACAAACCACTTACAACATTATCTACAACTGGCTTTGTCATAGAGTT[
A/T]AAAGTTCTATACAAATTCTCTATCAATTTCATATCCGTCATGTTATGGGTCGGACATTGTGCCATCTTTTTCTTTAATCTCTCCCAAGTTTCATGC
AATGCTTCAATCGGGAGCTGCCTGAAGTTACTGATTTCGTCCGTCAACTGTAACGTCCTAGAGGGTAGAAAGAACCTTTCTAGGAACGCCTCTTTTAACT
GACTAGTTTTCTATAGAATTAGGCTCCAGCTCATTTCACTACATTGTTGCATCCCCAGACAGAGACAATGGAAACAATCTCAACCAGATAATATTTTTGA
TGAC

chr04 48,500,309 C C T
GGTAGGTGAGTCCCCATCCT
AGAACTCAGGAAAACTCCGT
20
20
20
56.4
113
CAACCTGTAACCCTAGTTGGAAGGGTGTCAGTACCGTGCTATGGGTAAAGACACTGAAGAGTCACCCTCTCCTAGCAGATGCCTTAAATGAGAATGGTGG
TACCCTCAACTGGAAGGTAAAGCACCTCATCAACCATTAACTAGAAGATTGATGCCTCAACGTACGCTGGCCACGTGGTTCTAGAATGCAAGGATTGCTT
CTAAGGATCATACCCTCTACTGGTAGGTGAGTCCCCATCCTTGGGTTCACTCGGTGCTGAATCCTACTCCCAACTAAAAGACACTGACGATATACTAAA[
C/T]TGAACTAAATTAATACGGAGTTTTCCTGAGTTCTATAACTGACTGAGTTTACTAAGTTCTATAACTAACTGAGTTCTTACTGATCGTGACATAACT
GTTACTATTCTATAACTATTGTAGCCCAAGGTAAACAGTTGAATTTTTGTGTATTAAATACCCCTAGGAATCGATAGCATGAAAAGTAAAGCATAGCATG
ATCTTGAAAGACATAACAATGTACACTTGCCCATTATTCTTTCATGGAGATATTTTATCGAACATTGGTAGGGCATAATCTTGTACATATACTAGTATGT
CATG

chr04 71,504,129 G G A
GCTCAAGCAGTATGCCAGTTC
ATGGCTCAAGAGTACCCCCT
21
20
21
59.96
89
TTTCCTAGAGACTCTAGTCCATTGCAGTTCATATGTTATATTTTGATTATCTATGTGTTTTGATTAGTGGTAGTTGGAAGCATGTCCCAGCTATCTATAG
TCAGTATAATAGAGGCTTCATAAATAGTCAGTCAGAGTCACTACATGTAATTTAAGTTTCTTTCTTTAGTTTTATTATGTTGTAAACCTTATCAGTGTTT
CATTTATCCAGACTTTCCTATGATTATGCTTTCGCTCACAAATTTAGTTTTTATACAATTTAAATCATTTGCTCAAGCAGTATGCCAGTTCATGGGTTC[
G/A]CTTGGGATCACTTATGGTTCCAAGCATCATGCTAGGACTAGGGGGTACTCTTGAGCCATGACAAACTTGGTATTAGAGCACAGAGTTCAAGTGTTC
TATGGTGTCTATGAAGTCGTATCTAGTAGAGTTTTATGAAACGGTACGGAGATGTTTGTACTTTTTTTTTCAAGAGGCTACTAGGCATTTAAGAAATATT
TCCCTTCTTTCATATCTCAAATCGTGCAGTAGAAGTGTTCTCTAAGGAACTTATGCAGATTCTTACGTTAATCCATTCGTGCCAACTCTTTTTTATTCTT
GAGG

chr04 81,005,065 T T A
ACATGGTACCCCTCTCTTGA
TCAACATGAACCAAACAACCCT
20
22
20
58.63
142
AACCGTGGGTTTTAAAACTAATTGCATATTTGGAATCCCCAGAACGTAGTCTTCAAGAAACACCTATTATCTTTGCATATAGAGGTAGCTCAAAAATCTC
ATGGGCTTAAAAATTCATGTTTTCAAAATGGGGGTTTTGAAATTACGAATGACTATGTTTTAAATATTTTATGATATTGATTTGGTCCTTAGGCCTACTC
CCAAAGTGTTTTGATATATGATATATGTATATACATGTGTTTCATAATGATGATAAATTGAGAGCATGATTTACATGGTACCCCTCTCTTGATATGATG[
T/A]TGTTTTAAGTTTTCACATGATATGAATTGTGTTGAAATCATCTTGAAATGTATGTCATGATTTGGATATGTTTTTTTTTGACTTTCAAAGAAAGGG
TTGTTTGGTTCATGTTGAAATACATTGCATATGTTGATTGAATAAAGAGAATGATATGATAATGATGACTTGCAAGTTGGGTATGACGATACCCTACAGA
GTATGACATATGATTGATTTGAACAAAGTTTGAGTGCATTGATTTTCATGAGAAAGGTGGATAACCGAAGAAGGCATTTGAGTGAAAGGGCTCATCGCTG
GAAA

chr04 90,000,250 C G C
ACATGACATAGTCCACAGCCA
TGGGTCATCGTGGATAGGATG
21
21
21
59.03
82
TTACCAAAGGTAGATGTTCAACCTAATTTCCACTATAATCAATCACACATATATGAAGCATGTCCTCTAGTGCCAAAAAATCCTCTTTGCTAGCCCATTC
ATTTGTAGGTGGAAAGCAGTACTCCGGCTAACCTTAGTTCACAACCCTTTTAGAAAAGACCGCCAGAAATGAGATGAAAATTATGTACCACAATCATAGA
TAATCAAAATAGGTACCCCATGCATCTTTACAATCTCATGAAGATACAACATGACATAGTCCACAGCCAAAAAGTTTGTCCGCACTAGCAAAAAGTAAG[
C/G]AAACTTTGTCATCCTATCCACGATGACCCAAATAGAATCTAATTGATTCTAAGATCAAGAAAGACCGATAACGAAATACATACTGATTACCTCATA
TTTCTGTTTTGTCAATTCCATCTCTTGATACAGCCTACTAGGCCTCAGGAGCTCAACTTTAACTTGTTGGCACACTATACACTTTGACACAGAATTAGTG
ATATCCCTCTTCATACCATTCCACTAATACATCTCCTTGAGATCATGATACATTTTTGACGAACCGGGATAAACAACATAGCTCGATTCATGTGCTTTAG
CCAA

chr04 93,514,339 A A G
GCAAAGATAGATCGCTTGTAGCA
TTGGCATTGAACCCTCCCTT
23
20
23
59.51
150
TGGAGTTTGTTACCATAGATTGCATGCACTACAAAACCTCACCAGGTCCCGGCCAACAATCTGAATTTCTTCAATTAGATTCTTTGCTCTTTTCAAATCC
TATAGTTTATTCGATTCTGGGTTCGCCATTGTTTAATTTTCATCTGTGAGTCTTCAATTTATTTTATCTGTTCTTCTCAAAAATATATTTTTGTCAAGTG
GCAAAGATAGATCGCTTGTAGCATATAGAAGCTTTGTAGATCGTAATAGCTGTACTAGTTACAGATATGGTGAAGAAGAAAGAAGAAGCATTTAGGGGA[
A/G]AAAGGTGTAGAGGAAGAATGATTTGGCAATAAGGGAGGGTTCAATGCCAATCCCGTAGGTCCAAATTGTAGTACCTTGGCGACTTCTACCGTGAGA
TCAAGAGAAAGAAGGGTGAACACGTTTTTATATTTGACTAGTAGGGATTAATTGGTGAAAATAGCTACTATTCTATTAAAACCTTTTTTAGATCAATATA
TATGGTCGCATCATTGTTGGAAGATGTGAAAAGCCTAAAAGATGCAACATTAACTAAAATGATCTGAACTTGTGAAGTTCTAAGGAGACAGACCGTTGTT
CTGG

chr04 97,001,343 G G T
TGAGAGAGGGTTATGGATGTGT
TCCAACATCAACTTGGAAGCCT
22
22
22
60.16
143
TGCTATAAGTTCTTAATTACTAATTCATGGCAGAATATAGAACAAGCTACTTGGACACTATTTTTCTTTTTTATTAAGAGATCTCTTTTTTTTCTTTGGT
TTAAAGTATGAAGGAAAGTGAATGTTAAAGTTGTTGGGGAGTTCAAATTAAAAGAATAATTGCAGAATTGAGGTAAGGTGACTACTCTATTTTGTTCTCC
TTATATATGAATTTGAGAGAGGGTTATGGATGTGTTGTTATTAAGATCTCAAGAGATGATGAATACAATAATTAATTGCTACAATAAAAGGGATTTGAG[
G/T]CTGTTTTGTGGACTATTTTGTATGTGTATATTATAGGCTTCCAAGTTGATGTTGGATAAAGGTGTAACTAGTTTGAATTGAAATATAGAAGAAAGG
TATGGCGGTACACCACCGAACTAATTATTGCTTTTGGTTATTGCCCAATCTATTTTGCGTATTGTTTGGAGAGTGTAATGAAGCCAAGGTGGTTTTGGTG
AATCTTATAAGATCATGTATGGTATGTGGGTGCAATTGGAAGAGAAAGGGGTTTAAATAACTCCCTTGATTGATAGATTAAAGGCTTACTGCCCGGTTAC
TATT

chr04 143,001,668 A A G
ACGGACATATCTGATATGGACGT
AGTCTTTGGCTACTACACTTCA
23
22
23
56.78
143
AGACATCCAATCACAAGAAGGTCATGACACTCAAAAAAGCATAGCAAGAGAATTAATCAAATATCTTTGAAATAGAAGGAGAACCACCATCCTAGAAACA
CGACACAATAGATAAATCAGGATCTAAATGATAGAAGGAAGGACACAATCGTTACATGGACATCAATACCAAAAGGAAAGATAGATCACGGACATATCTG
ATATGGACGTGATTCAAAGTCATATATGGACATATCAAATGGATACATTCCTTAATCAAGGAATCAATTTAAATCCTTAATTTAAAAGAAATCTCTTGG[
A/G]TTTCCTTATGAAGTGTAGTAGCCAAAGACTATAAAAAAAGAAGTCCGAAGATAGACACTTCTTACACAACTTCAAAGAGAAAATTCAAAGTGTCTC
ATTCTTAGTCTTAGAAAGATCTGTAACGTTAGTTTAAATTTTTTTTATATAAAGAGTAGGATCAAGTCAATTTTGTAACATCAACTGAATCTGTGTCACA
AGATCTTAAGAGAAAAATAAGTCTTCAGAACTTATTTCGTATGATTGTACTTGAGATAAACTTTCAACGATCGAAGTAAACTTTGAAACCCAAGGGGAGT
GGAC

chr04 150,000,327 C T C
ATTCGACACCCAGCCCAGTT
TGGCTATTTCACATCCACACGA
20
22
20
60.03
111
AATTACTCTTGTAATTAGAATTGTTCATTGGAAATTCAAAATTGTTCACAACCCTAGCTGCTTAAGCATCTTGATAACCATAACTCTAGTTTGACTATTC
TTACTGAATTACTATTTACAATACCATCGACAGTTGGATTATTTTCTATGATAAGCATTTGAATACAATTGATAAATCAAAAGCCCCACTTTATTATAGA
ACCCTTGATCAACAGTCTAATAATAACCACGCTACTTAGTGAACACAGTATTCCCTATGGGATTCGACACCCAGCCCAGTTGGGTTCTATATTTGACAG[
C/T]GACTGCTTACACTTTCTAATGAATCACATATCTTTTATCATTCCTTTAGATCGTGTGGATGTGAAATAGCCATTCCTACGAAGAAGTCCCAGTTGA
GATCCTTGATCGTCAAATTGGTAGGTTAAGAAATAAAGAAGTCCCCTAAGTTAAGGTTCTATGGAGAAATCAGTTTGTTGAGTGAGCTACTTGGGAAGCA
GAAGCAGATATGCGATACAAGTACCCCCTATCTTTTCTCCGCAAATTCAAATTCAGCTTGACGTATTGGTTTCCCTTAAATAGATTCTCTCATTTCCTAT
CTCT

chr04 163,000,215 T T G
TGAGTTCTGCTCTTGATTGCT
ACGAGTCCCAAATTTGCCCA
21
20
21
60.18
141
GTTCAAGGTTTTAGTATGCACTTCTTATAATTCATCACATAACTATTTTTATTTCATGAAAACTTATAATTAGTCATGAATTGAAACCCAATTAATATCA
TGAACATGAGTACAATCAATTTCAAGCATGGAAATCATAATTCTATAAACTTGTAGTTTTAAAATTGGATTCTTGGACTCTATGGGTGAAATGAACCCAT
AGATGAACACCTAACATACCTAAATTTATAAGTTCTTAGAGTTCTTGGTGAGTTTCTTGAGTTCTGCTCTTGATTGCTTTAAGATTAGGGTTTGTTAAT[
T/G]GAGAGAGAGCTTGTTGATTTTGGGAAAAATTTAACATGTAATGGGTTTAAAATGTTTTTAAGGATTAAATATCATATCTGGGCAAATTTGGGACTC
GTCACGATGCGGTGAAATTGCGTGGCTTCACTGGAAAAAGAAAAATTGTGAATTAGGTCTATGGTGTGACTCGCTATTATTGCGGAGCAATACTGGAATT
TTAGAATTGTCATTCGGCTTGCCTACGCAATGCGGTGAAGTTCCAGGTGGCACACTATTTTATAAAATATCCTATAACACTTCACCTGTGTATTAGATTT
GGGC

chr04 183,000,013 C T C
ACAACAACATCAACGTCACA
TGTGGCAGTCCTAAACACTTCA
20
22
20
59.83
149
ATGTGTGAAAGTGTGGCCTCTTTGAAATTTTCTTTCTGTTGTTCACCATCCAAATCAGCAATTGTAAAAAGTGCTAGAGTGTCCTCATCATCAGATTCCA
CCATAGCTAGTAATGACCGATTTTGTGGTTCTTCATTTTCAAATTCATCAGAAGAGTTTCCCATTTTAGCAAGAGCCCTTTAACAACAACATCAACGTCA
CATTTTATCATCATTCTATGTGATGGAAAAACCAGGTCATTCTTTTGTTCCTTATATTTTTCTTGGTTATTTTTCTTGTGCTCCTCTATCCATAAAAGA[
C/T]AAAATTTGATGAAGTGTTTAGGACTGCCACAATTGTGAAACACTTGATCATGATTTTTCTTTTCATAATTTCTCGGAACCTGGTTCCTATTTTCTG
AATTTAGGCTCTTCCTAAACACCTTTTGAAATCTCCTAGTCATGAGTGCCAAATTCTCAGGTTCAAAATCTACTTTTTTAGTAGCTTTTAGAACCAAATT
ATTTTCCTTTGAGACCCCAATAATTGCGCATTCTTAATTTTCTTAAGATCATATGTTTTCAAGTTTCCGATGAGTTTATCCATGGTTACTGTATCCAAGT
TATA

chr04 195,001,585 C C T
AGCCACCACATCTCTCAAGT
AAAGCGAAGGAGGATGCACT
20
20
20
59.67
128
TACCACGGTGGTCAGTCTCGGCTCTCTCAAGCCCAATGTTTTAAATAATGAAAGAGGCATCAAGTTAATGTTTGCCCCTAAATCACCCAAAGCATGGATT
ACTTTATCTCTCAATTTCTTGGGGATTTTTTATGTCACCATAGCACTACACTCTTCAAAGAGTGTTATAGCTCCCACATCCTGCAATTTCAACTTTTTAG
CCACCACATCTCTCAAGTACTTTGTGTACTTTGGCATACTCTGCAAACATCTAACAAAGGTAAGTTAATGTGAAGCTCTTTGAATGAATCAAAGAACTT[
C/T]TTAAATAGTGCATCCTCCTTCGCTTTAATTTTTCTCTGAGAGAAAGGTAATGGCAGTGTTTTCTTCCTTTCTGATTCAGCAATTTTTTCTTTCAAC
TACTCAAACTTCCTTGATTTTTTAGCAATTTATTTATTTACTTGATGGGTCACTACAACAACATCTACCTCCTCTTTTACCTTTGGAGGTTCTCCTTGAA
GCTTTTTACCGCTGCTCAAGTTGATTTCCATGACTTGCTTTGGATTTTTTGGGCCAGCTGGTAACCCACCTTGTGGCCTAGTATTTACTGCTTGCTGATT
ATTT

chr04 199,500,153 A A C
TCATTCATCCCTAGGTCCACC
TGCATGGTGTTGGTATTGCA
21
20
21
58.37
133
TGGATTTGTAGTTGACTCTATGAGATCATTTATTCATCCCTAGTTCCACCTAAATAAACCTAGGTAATGTTAATCCTACCATTACGTTAATGAGAGCTTA
TTTAACTCAAAGTGATCGATCGACGACCCAGGTTAGGATAAACGCAATACCAACACCATGCAATTAGAAAGACTCAATTAGATTTGTAGTTGACTCTGTG
AGATCATTCATTCATCCCTAGGTCCACCTAAATCAACTTAGGTAATGTTAATCCCAACATTAAGTTAATGATAGCTCATTTCAAATCAGAGTGATCGAT[
A/C]AACGACCTGAGTTAGGATGATGCAATACCAACACCATGCAATTTCAAAGACTCAATCAGATTTGTGGTTGACCCTGTGAGCTCATTCATTCATCCC
TAGTTCCACCTAAATCAACCTAGGTAATATTAATCATAACATAAAGTTAATAAGAGCTCATTTCAACTCAGAGTGATCGATCAATGACCCAGGTCAGGAT
GAATGCAATACCGATACCATGCAATTGCAAAGACTCAATTTGATTTATAGTTGACTCTGTGAGATCATTCATTCATCCCTAGGTTCACCTAAATCAAACT
AGGT

chr05 672 G C G
GAGGCGACAATGCTAGAGCT
GCCTTATTTCCCCCTGCTGT
20
20
20
60.03
124
GCGAAAACCTTGTAAAATTATAAATTAGAACCCATACCCAACCTATTAATTTAGAACAAACTAAAAAGAAAATAGTACTAACAATCAAATACAATGTCTG
GGAAGTCCTCTGCATTTGTTTATGTATTGATCAGTGAGCCCTTTACATTAAAAAGTGAATGGGAGAAGCAAATGCAGCTCCATCATGCTTTTATTTAATT
GAGTAATCAAGGTTGAAGCCATTAGAAAGAAGTTGTAGAACTAGTAAGAGGCGAGGCGACAATGCTAGAGCTATACTCAAATCACAGCATAAAAAGTTA[
G/C]CTAGTTATCTCACAACAAAAAAAGGGCATGCCTTTCTTATAGAGATAACTAATAGCACAGCAGGGGGAAATAAGGCCAGCACATGAAAAATAAAGA
AATTTACTATCTTAAAAACATGGAGTAAACGCAACCTGAAATGCTCACTGATCCAAAAAATGAGGAATGGTCAAGGATGGACCAATTTCAGTATAAAAAA
CCTACAAGTATACCCGGGTACGGTACTGCAGCCAATGTTGGCCTAAGCCTTGAACCCAGTTGATGCTCCGATTCTGATAGGCAAGTATCTTGGCTTAATC
TGTG

chr05 11,500,411 G A G
GGGGCTATAAGGGGTTTGCA
TCACACAATCAGAACACATCTCA
20
23
20
58.04
143
TCTAAAACATGCCTGAGTCCCGGACCTACCCCCGTAATCATGGGCTATAGAACATCGATTTTGCCCTTAAATGTTCTGTTCGTGCCGTTTTGCTCGTATA
TATGTCTACCCCAATTTTAACAACCACATTGGAGAGGTTCTTATCTATATTTTTCAATTAATGTTCACTTTTAGTATATGGGTATCTTCTAATTTTCTTG
CTAGTTTCTTAAATATAGAGAGTTTAAGATGGGGCTATAAGGGGTTTGCAGGAATCTAAGCGTATTTTACTTTTTAATTTAGGATATATCGTGAGGGAA[
G/A]TAGTGAATTTTTTTTACTGCCAGATTGATCTGTTTTGTTAGAGTTGTGATTGAGATGTGTTCTGATTGTGTGAATTTTTTTTGCTGCCGGATACTA
AAATGACAACTATATTTTAGATAGTAATGATTATCAAACTATTTTGTAATAATGATGGAACTATTTTGTGACAGTTATAATTGTGGGTCAAATAGTTCTT
ATCATCACTACAAAATATGTCTAAAACATTTTAAATAATATTTAATGTGATTATTTTATTAAATTTCTTAGAATGTTTTAGAAATATTTTGTATGATAAT
AAGA

chr05 14,000,093 C A C
TCAATGTTACCACAAAGAAGATGT
TGCACTAGGTATGTAGTTGCTGT
24
23
24
59.49
133
ATTAAAATTTAACAACTATGTACTTCAGCTAATCTCANTATCAAAATTTGAACAAAAATACTTCGACTCTCTATATATATAGTTTTATATGAGAAAAGGG
GAAAATATTTTTCGGCAATCACTGTTATGCTTTGTTTATATTGAACTTAAATCAAATATAGCATATATTCATTCAGAATTGTGGAAGAAGGACATAAAAC
ATTGATACATATTTATGGCCATAAAACAAAATCTAGAATTGAACTTAGAAAAAATCAATGTTACCACAAAGAAGATGTGACAAACATTTTTAATCAAAT[
C/A]TATGTTTTAACCCTTTGTATGAAATGTGAGAACTTGCAATAAATTATTATATGTAAATTAATACACAGCAACTACATACCTAGTGCAACACACAAG
TTGAATTTGAAAGGCTAAAATGCAAAACCTTAAGCCTACTTTCATGGGACACAAAACTTGTTTTTGATAAACCTTCGATTGGAAAGTTTTTTTTTTTCTT
GAAACAAGGTTGAAAGAAGGAAAAGGGAGAAATAAAAAGGAAAGAGTAAGCATTTGACATTCAATTAAATATAAAAATCTAAATCGATCAATTATTAAAA
TTCA

chr05 72,008,622 G G A
CGCTGGCACCACTACTAGAA
AGAGTGAAGTGGTGGCAATACA
20
22
20
59.63
138
GCATGAATACATGAGTCATTAGATGCATGACCTGAGTTTGGAGTTCATAAGTTTCATGGAATATGATTCGTACATCTAAGCAAACTATAACTCATTATAC
TAAGAACTAGAAGCACACATAATTCTATATGATATTCTATAATGTGAACTATAATCATGGAGCTAACATATAAAGTCTGAGTCGATGTCATGATGACTGA
AGTTCAAAACACTGAACCGAGATGAGGATGGGTCAGGAATCACCCTACCCTACTAATATTCTGCAATACGCTGGCACCACTACTAGAATCCGAGAGCCT[
G/A]ATTTGGTTACTTGTTCAATCATCTCTCCCTTAGCTTAAAACCATGATTCAAAGTCTTGGAACCACTTAATCAACATCTCTAATATGTATTGCCACC
ACTTCACTCTATAATCTGGGGTATGAAAATACACATAATAGGTAAACTTACTCTGAATGACTATGCCCGATAATGTAAAACTCCTACTAGTACTTTCTTC
TGAGATACAACTCTTAGCTTTCTATAGCCCCAACAATCATCATGTAACAACTTAAAGTTGACTAACTTACAATCTTAAAGTTGACTAAAGATTTAAACTT
AGAT

chr05 80,003,316 G G A
CCCATCCTTCAGATAAATGTAAGC
GCACTAATTTCCCTTGAAACGT
24
22
24
57.5
150
TCAAATTATCATCCATCAAGAGAAAAGGATCGGCATCAAGTAGTTCTTTGTACCAAAGTATTTAATACTAAAGGTGGATCCAACAGGAACAATTTCACTC
TCTATGAAGGAACATGTAGGACCAAAAGCCGGAGTGCCCCTTATTTTATGTCTACTACCAGTTCTTCTTACCAAACTATGACCCATCCTTCAGATAAATG
TAAGCTAATGAGCTCAGATATTAATGAATTCTATAGAAGATTTATCTATAAAAATAAGACTTTCACCGATCTATTAATAATATGCAGAACTACAATGGG[
G/A]GAATTAGTAACGTTTCAAGGGAAATTAGTGCAAGAAAATGTGGATATAATTATTGATATTGAAATCTATAGAAAACCAAGTGAGTTCATAAGTCTT
ACGTCAGAGCTTATTATAAGTTATAAGAAGTGAGAGCTTCCAAAAGCAATCTTCATAAGAAAAACAAAAAGGCTCTGTATCACAAAAATCAATCCTATTT
AGTTTAATCCTTCTTCAATCATAATAGGGAGCACTTGGAATCTAATGAATTCAGACAAAGAAAGTGCCTAGTCATTAGTCTCGATAATGTGATAATCGGG
TTAT

chr05 82,505,248 G G A
TTAGCCATGAAAGGGTTCCT
TCCCCTTTTATAGACTCCAAAAA
20
23
20
55.2
92
AATTTTATAACACACACCTCACTATTGCTCAAACATTGTTTTCCATAACACACTAAGACACACTTTCTAAAATCCACACCATTAGGCACACTTTTTGATC
ATGCATAAGTCCCTATGGTTAATTTATTTTTGTTTATGTGTTGTGTGGATGGTTAATGTTAATTGATGGTTAGTAAATATTTCTCCATAATTTATTATTC
AAATTTTATTTTTATTTTTTATATGAAATCCTATATGTGTCCTTACAAAGATTACTTTTAGCCATGAAAGGGTTCCTTTGAATGAAATTGGAGATCATC[
G/A]TGTTTAAATTCGTGGGTGCATTATTTTTTTTGGAGTCTATAAAAGGGGAATTTTGATTCCTCTTGGAATCAAATTTTCTATGAATATTACAGTTAG
TGTTGAACTATGTTGGATTGAGGAAGACGAAGAACTTGTGCAATGAGTTTGAGTCTTTGTGTGATATGTTTTATTATCGTGAGATGCACGAAAATGAACC
ATGTGAAAGCATTTCAATTATGTATCTAAAGGTTGGCTAAGTGTCATTTGTGCACGTTTCATTATGAGAGATACACACAAAAGTCCTCTTGAGCACCTAA
TGTG

chr05 117,000,262 A T A
TGTGATGGCATTTTAGGATTGTGA
AGCCTACCTCAAAGCCGAAC
24
20
24
60.04
83
TTTTTGACCCAAAACCCCCAATTCACTTAGGGCTTGATTTTAGCCCAAAGTTTGCTTAGTTTGCACCCATTTTTTATGGTTTTCATTCTATGATCTTGAT
ATCATGATGGGTTGACCTCAAAAATGTATTTTCCATAAGTAGAACCCACTTGGGGTTTTTGATATCATTTTTGGACCCAAATCACCATAGTTTAATATGG
GTATCATTAGTCTCGTATTGATGAGTAGATCATGATTTTGATAGTGTGATGGCATTTTAGGATTGTGAATTTAAAATGGATATTAGTGAATTATATGAG[
A/T]TTTTGCGGTTCGGCTTTGAGGTAGGCTTCTACCTACTCTTCTTCGAAGATGATGTGTGTTATAAATGGCATGTGAATATGAATGTTAGGATTTATT
ATGGGTAGAATAACTTAACCTTGATTATTGATGTTTGGGGATTATATGAGGATTTTAGACACGTACGGTGGTATGTTTAGGACCCTTTTTTGAATCCTAT
TACTTTCTCCCTAGATTGGACTAATTTGTAGTATGGATATGATGTAATACTTGGTTTGGGATGTGATTTAAGCATTGGAATCATGGTTAGTATGACTAAC
CTTG

chr05 126,001,582 G T G
CAGAAGCACAATCTTTGGTGAGT
GGGCTAGGGTTTTCTCCTCC
23
20
23
59.45
85
CATGGGGAATATCAAGATAATGCATTCAATAATAATGGGTGAAAAACTCCAATTCAATTTCATGTAAAATCTCATAGATTTCAGGAAAATCATAATGTAA
ATAAGCCTTTTGGGCACAAGAGTGAAAGGGTTACCTTTGTTCAAAACCTCACATACCTTAAATTAGGAGATTGGATGAATAAGTTTCCTCTAAACTTCCT
CTTATTACTCTTGAGAGAGGGTTCTTGAAGTCTTTGAAATTGGGAGATTCAATTCTCAACTCAGAAGCACAATCTTTGGTGAGTTCTTAGATTTCTTGG[
G/T]GAAAAATTCTTGTTTTGATATAATTTGGAGGAGAAAACCCTAGCCCTTAAGTATTAGAGATGAGAAAATGAGGCCATATAGTTCATCTAGAATATA
TATATAGGGGTTTAAAGGTGTATAAAGGACCAAAATACCCTATTAAAAATGAGTTAAAAATTGTTCATCGGGATCTGCGACGGTCGACATGATGGTCCGT
CGGAAGTTTGATGGTCCGCCAGATCATTTGTTGCTCGAGGACCAAAAATGAAATACACTACCTTAATGCGACGGTTGGAATGATGGTCCATCAAAATTTT
GACA

chr05 126,518,376 G A G
TGTCACACTGAAGGATCTGACG
TCACCTCATTCAGTGTGACATGT
22
23
22
59.93
139
AGAGGTGACAATCCATAACATAATAACATGCCACTCTAAAGAAGGTGATGATCCAAACAAGATAACATGTCAGGCTGAAGGAGCTGACGATCCATAACAT
AATAACATGTCACACTAAATGAGGTGATGATCCATAACATAATAACATGCCACTCGGAAGGAGATGACGATCCAAACATGATAACATGTGAAGGAGTTAT
GATAACATGTCACACTGAAGGATCTGACGATCTATAACATAATAGTATGCCACTCTAAAAGAGATGACGATCCAAACATGATAACATGCCATGCTAAAG[
G/A]AGGTGACCATCCGTAACATGATAACATGTCACACTGAATGAGGTGATGATCCATAACATAATAACATGCCACTCTAAAGGAGGTGACGATCCAAAC
ATGATAACACATTATACTGAAGGAGGTAACAATCCATAATATAATAACATGTCAAACTGAAGGAGGTGACGATCCAAAACATAATAACATATTGTCTCAA
ACAAAGAGATGATCTTATGCACCCTCTTAAAGGGTGAAAAATCCAAATATAATAAGTTGCATCCTTTTAAAAGGAGGATGTCCCAAATATAATAAGATGT
GTTA

chr05 141,511,640 G T G
ACTAGAGCTGTCAATATGGGCT
CGGGCTTATTTTGGTCGGGT
22
20
22
60.68
128
TCCGAATATGAATTCAAATTTGAATTCGAAGACGAAGCCAAGCCGAGCGAGCAACTATGACGACGGCACGATACACCTATTATTTCTTGCCTCGCTATCC
ACTTGAAGGAGTGTTTCTTATTAAAAACACAATATAGTTGCTTTCTCCCACCAATGTAGAAAAAGTGTACTCTTCTTTAGTGAGTACACTTTCCTTTTAA
GTGTGCTTATTTTTCCTCCAAGAATTTTCTCCATTTTCCATTCACACATCCTATTTAACCCAACATCTATAACTAGAGCTGTCAATATGGGCTAGGCCT[
G/T]TTGGGTAGGTTCAGCCCGACCTATAATTTGATAGGACTGCGCTATACTTTTTATACCCTATTTAAGAATAGGACTTTTTACCCGACCAAAATAAGC
CCGTTGTCCCGCGGGGCTTGAGCAATATGAGTTGAGCTGGCCCGTAGGGCAAATAAAAATGATTAAAAAATAGAATAGAATACTAAGTATAAAAAAAAGA
GCCCAAACTCAAAGTCTTTTNNNNNNNNNNNNNNNNNNGATGAAGATAAAGTGACGATGTTAAATATGCCATAAGTTCCATGGGAGTTTTTTTTCCGAGG
AGTT

chr05 161,503,875 C A C
AGCTTCGGAAGGATAAGGGAC
TCCATCTTAAGTGTTGGCCATGA
21
23
21
59.99
138
CAATTCTAATGTAGAGAAAGCAATAACAAAAGAGGAGGTATATTTGAGGTTTGTCATCAATATAGAAGTCTTGAGAATTTTATTAAGGATTGTTCCATGC
ACAAACTAGATTATTAGGACTACCTCAAGACTGGGAGTGCAATGGAAAGAATAGGGACCTAGTCCCTAGACATTCAAGAAGGAGTGTTGCAACTTATTAT
GCATTAAAACAAGCTTCGGAAGGATAAGGGACTCTTCCACTGAATAAGATAAAGATGAAAAACATGAAGATGTGTCGATGTTAGCTGTTGAAGAGATTC[
C/A]TATTATCTATGACTCCTTATTTGCCTTCATGGCCAACACTTAAGATGGATAATAAAATGAGGTAACTCTTTCTAATATAAAATAATCTAGATAAAT
TTTCTGCTATGAAGAATCAAAATCTTTCTAGTGTGTTGATAGACTCTGTGTGTGAACTTACCACTGAAAAAAATGCTCTAGTAATGAAAGTTGTAGATCA
AGAATTGGAATTGATCGCATCAGTTCAAAAGGGTATCGCTTAAATGTCAAACAACTATCTTTTTAATTATAAATTCAAATCCTCTTCTTAATTAACAAAT
AATA

chr05 176,000,158 A A G
CAGTCCTGGAGCCAGAAGTG
ATATGCAGCCGGATTGTCCC
20
20
20
60.25
108
TATCACCAACAAATACCATACTGCCCCTATAGACTCTTCTGACAACTACGGAGTCTCCCACCAAGGTCAAAATAGAAAATGTGTCTGAAATACACTCGGG
ATTAAAACCAAAATACACAGCCATAAATGGGGTCACATAAGAGAGAGTGGACCTTGGATCAAGTAAATAGTACACATCACGAGAAAAGATTTTTAATATA
CCAATAACAACGTTAGGAGATGCCTCAGACTCCTAACGATTAGTGAGAACATAAAGGCATTTTTGATCAGTCCTGGAGCCAGAAGTGGAACTCTTAGGT[
A/G]TAAGAGCTAAAGAAAAGGCAACAGGAACCTTGTTTGCCTCAGAAGCAACTCTAGAGGGACAATCCGGCTGCATATGTGCTATCTGAACATACATAA
CATTGGTTCCTCCCTTTCTCGCACTGACCATGATGGTACTAACCACAGAATTTGCAGAGGGGGTAGGATAATGCTAATTAGGCCCTAGTGGCCTGAGATT
AAGCACCCTGTGCCATAGAAGTATCACTGCCCTAAAACATATTGATTACCAGATAGATTTGGATAAGGAGAACTAGTCGTCGAGTAGGAGTTAGGACTCC
CCCA

chr05 191,000,465 C G C
ATCGTATGGCTCCAGTCGAG
CCCATGGAGAGATACTGGGC
20
20
20
59.31
93
AGTCATTTAATATCCTATATTAAGGTTAGAAAGTTGATCTCTAAAGGGTGCATTTATCATCTAGTTCGAGTCAAAGACATTACGTCTAAGGCTCAAATAG
TTCAGTCTGTCCGTGTAGTGAATGAGTTTCCAAAAGTTTTTCCTGAAGATTTACCAGGGGTACCTCCCGACAAAGAAATACAATTCGGTATTGATCTTCT
TCCTGATACTCATCCCATCTTCATTACTCCATATCGTATGGCTCCAGTCGAGCTTAAAGATTTAAAAAAGAAACTCAAAGATCTTTTAGATAAAGGTTT[
C/G]ATAAGGCCCAGTATCTCTCCATGGGACACTCCCATCCTATTCATGCGAAATAAAGATGGTTCTTTTTGAATGTTTATTGACTATCATCAGTTGAAT
AAAGTCATAATAAAAAACAAATATCCTTTTCCTAGGATTGATGACTTATTCAACCAACTCCAAGGTGCAAGTTATTTATCCAAGATAGACCTTAGATCCG
GTTATCATCAACTTAGAGTAAGGGAATGTGATATTCCAAAACTAGCTTTCAGAACTCGTTACGATCATTTTGACTCTCTAGTCATGTCATTTAGTATTAC
CCAT

chr05 201,501,504 T T G
GACACCCTGGGACCATGAAC
GAGGTGTTTCAGGCCTCCAT
20
20
20
59.67
105
GACAACCCTCATCTGACTAAGCATTGTAATAGATGATACTACGTGGAGGCATAACTGTGTTTTTCAAACACAAGTGATCATTGATTACGAGACAGTTTAG
ATTCTTAAGCATGAACTAAATCACAAAGAAGGGAAATATTTCCTAAAAACCTAGAAGCCTCCTTCTTATAAGTGTGGCGCGCTACACACTCATAAACAAG
ACTCTACTTGATACGATTTCACAGACACCCTGGGACCATGAACCATGTTTTGATACCAAGTTTGTCATGACCCGAACCAGGGCCTGGACGTGACAAGCA[
T/G]TTCAAAGAATGGAGGCCTGAAACACCTCTATCTGTCTTGTAATCATGCACCTAATTCATTTGATCAAAGTAATGTAGAAAAAAATACAATAATATA
GAAACATGATCATAAATATGAAAGAAACAATAATGGGGAGATAAGATTCCCTCAACATCAATTAACCTCTAAACAACTGTCTGCAAAAATCTTTAACAAA
TGACTGAGTCAAGAAACCTATATAAACTGGGACAAGGTCCCCAGTAGACCCCAAAACTGAATATAAGAAAAAAAGGACTGCAGGACATAAGACCTTCAGA
AACA

chr05 212,500,095 T C T
GTGAAGTGGTGAGGCTCCAT
GACATGCCCCCGACTATGAT
20
20
20
59.31
116
TCTGACTGTTTTTGTGACAAATAGTTTTGGAAAAATATTTTGTAAAAAATAATTAAAAAAAGCTATTTCTGACTGAAGTAATCGAAAATTTTCGACTACT
TTTTTCAGTAAAAAAATAGCGAATTTCTGGTAGTGTCATTTTTCCTTGAGCTACATGTTAGTGCTCACCTCACTGACCAACCCTGGACGCTGCATCATTT
TTTGATGTAGGGTCCAAGGTCTTTTCTGTTATCCCTATGCAGCGTTAGGTGGTATGGTTCATCTTTTGAATTGAAGTGAAGTGGTGAGGCTCCATCTTT[
T/C]GGAAGACCCTGTCATTTCACTAGGTTCTTTTTTATATTTTGAGATTTATGGGTTGTCTTATCGGTTGTCTTATCATAGTCGGGGGCATGTCCCAGC
TTAATTTGGTATTCTGGATTTTAAAGGCTTTTGTGGACAGTATTTGGGATGTCGTTTATGTCTTACTTTGACTCTGTAGATTCTCTTTAAATTTTATATA
TTCTTTATTGGTTTGGTTAGCTTCTGCTGTTTATATTTATGTGCTCTTAAGGTAAGGTGAAGGGGGTGGTCTTCGACCCACGGTGGGCTCGAGATACCCT
TCAC

chr06 17,001,761 C T C
TCCCTACCAGGAGGAACACC
TCGGAGGGTCTTTCTTTGCA
20
20
20
59.24
92
CCTTGGAAGAGGGTACTTATTCTTTATCATTGCATTATTCAACTGTCGATAATCAATACACATCTGAAGGAAACCATCCTACTTATGCACGAACAACACC
AGTGCACCTCATGGTGGCACACTAGGATAGATAAAACCCTTATCTAAATAATCCTTTAGCTGCTTCTTAAGCTCCTTCAACTTAACTGGAACCATTCTAT
ATGGAAGAATAAAAATTAAATTAGTATCCAGAACAAGATCAATCCCAAACTCAATCTCCCTACCAGGAGGAACACCAGGAAGGTCATCAGGTAAGACCT[
C/T]AGGAAATTCATTCACCACAGGGACTAAATGCAAAGAAAGACCCTCCGAGTTAGAATCTTTAACCCAAACTAGATGATACAGACACCCTATGGATAT
TAATCTCTGAGGTCTAATATATGATATAAACTTCCCCTTAGGAGCTAGAAAACCACCTTCCCACTTAATAACCAGCTCATTAAGGAATGTAAAGACAACC
TTATGAGTGTGACAGTCTAGAGACGCATAGCACAAATGCTAATAATTCATCCCCAATATGACATCAAAATCCATCATATCTAATTCAAATAGGTCCACCA
CGGT

chr06 30,004,598 A G A
AGATCCGCACCCCCTACTAA
TGTTCTTGCACATAATCAAGGAGA
20
24
20
58.44
150
AACACAAGATAATAAATAACATTGAAAATCTAGAATTAGATATACATTACAGTACAATTAGGATAAATTATTATACAGAAATCTGTAACTCTGCAATTAC
TACAGGATAAAATAATAAACCACACAAATTAATGAATACATCTTACGAAAAGAATAAATCATTAAAAGTTATTGAAACAAAATTAAAGAAATATCCACGC
ACAAAGAAAAATAGATTCATTATACATATAATAGATCTATTTCGTAAGTTAGCTATCCGCATAGATCCGCACCCCCTACTAATATTCTGAAATGAAGAA[
A/G]ATTCTTTGAATTCATTTTATATCTAATTCCTACCTTATTGATTTAGTATCTTCAACCTGAATTAAACGTGATTTTAAAGATGGTATTTTCTCCTTG
ATTATGTGCAAGAACAGACAAACAGTGAAAGCTTTATAAAAGATCTACACTAAAAAAATTGAATGTTGCAATAACAATTACGCCTCAACTCAAGCAAGTT
GTATTAGGCGATATGAATCCTCATGGTCCATGCTCCTTTTAAGCCTGTGTCAGTATAGTACAATGTATTACATTGTTACAAACCAAGCAAATTTGCATAT
AAGC

chr06 37,503,661 G A G
AGCCTACTCGCCTATCCTCA
GCATCAGTGGCCCTATGGTT
20
20
20
60.11
100
TCTGTCATACACAGACCTTCCTAGGAGATCTACAAAGCCATCCGCAATATATAGGGCCTAGACTGAGGGCCTAACAGTTTCCATAGAGCCTATTGAGGCA
CATATAGGAGATGTAGTTATTGATATTGATATAGAGATAGGGGATCAAAGACAGGCTCCAGATTTGAGTGCACAGGGCAAGGGGACACTAGTTATTTCTT
CATCAGCCTTGGCTTCAACTTCAGAGCTAGTTAGCGTATCTTTAGAGCCTACTCGCCTATCCTCAATAGCTCATGCTAAAACTAATATTACTAAATCCA[
G/A]AGAGTTCTTACAGAGCTTAGTAGACAACCATAGGGCCACTGATGCTCGATTGAGGGTTGTTAAGACAAAGATGACTACCCTCTATGAGTAAATAAG
ATCAAGGGTGCAGACCAGATTTGAGCAGGTAGAGGCCATATGGGAGGACACATAGAGAGCTGCATTGTCGGAGCTACGTGCTGACTTTTACATATATCTT
GATGTGTTTAAAAGATGAGTTACATCCTGATTCATAGAGATAAATATGCCGAATCTAGCCCAGATGATAGAGTATTTTGATATACTATGAGCAAAGATAC
ACTC

chr06 52,506,089 C T C
GGGGCTCCCTGTATTTGCAT
GCATCTACCTTCACCACGGA
20
20
20
59.46
143
AAGAGAAAAATCATGATAATCCATAAATGTGGGCACCAACTAGGTACCCAAGCATCTTATAACAAAACAAAACAAAAATAGTATCAAGAAATCATCAAAA
AAGGTATATGGTAACATATCATAAAAATAATATAAATCTAGGGCCACCTCTACTGAAAAAAATGTAGTGACCACACTGCATGTACCAGAAAGCAAGAGTA
TAAGGGGCTCCCTGTATTTGCATCACAAGCTATCCTCTCCTGCTGACATGCCATCACCACCATCTGCACCATATCCACTATTATTGGTACCAGACCACT[
C/T]AATAAGGGCTCTATCATCACTCTTGATCCGTGGTGAAGGTAGATGCTTTTTAGGTTTTAGTACCCCAAAGATGCCCTTTACTCTTCTCCATATTTT
GGTGATGAATTTTTCTCTCTTTTTTTTCCCTCTTTACCATCTTTTCTTATGAATCCCTTAGGTCCCATGTGATATTGCCAAAGCTGAATATTCTCTCTCC
AATCTGGAAACCTTCGTACCCTATTTTTTTGCTCCTCCTAATATAGTTCATAGTTGGACCAAGCTACATATAAGTAGCTTGCAGTGGATAATTCCCCTGG
CCCC

chr06 53,003,159 C A C
ACGCAATAACTATCTCCCCCT
TGTGTTCAAAACCCTAGTTCCGA
21
23
21
60.12
146
TATAATTCTGATGATCAACCTTAACCTGCTGATATATAGATCCCTTAGCCATAAACTCTGTAATATCTCTTTTTATCCCACTCCACCAATAGGTTTTATG
CAAATCAAGGTACATCTTAGTGGCCTTTAGATAATTCGAGTAACACACATCATGTACTTCTGCAAGAATTTATTGCCTTAACTCATCTACACCTAGCATA
TACAGATGATCCTGACAACGCAATAACTATCTCCCCCTTGGGAGAAAACCTTAACCTTCTAATCTATTATTGACTCTTTTAACTTGAGTATATTGGGAT[
C/A]TCTATCTTGTTTTTTGTTAATTTTCAAATCTAGAGATGATTCGGAACTAGGGTTTTGAACACATATATTACCCTCGGCTAAATCAACTAAGCGGAC
ACCTAGTCTGGCTAGCTGATGAACTTCCTGAGTTAGCTTTTTCTTACTATCTTCAAAATGACAAACACTACCTATAGATAGTCAACTGAGAGCATCGTCC
ACTACATTGGCCTTGCTCAGCTAATAAAGGACACTCATATCATAATATTTTAGGAGCTCTAAATACCTTCTCTATTAGAGATTAATATCTTTCTAAGAGA
ATAC

chr06 64,502,257 G T G
GCTATTCACCCCAGTTCCACA
CCCGGGCCTTATGTTCTCAA
21
20
21
59.75
140
TCTCTTGTTGTTGAGATAATTGAAAAATGTGTATTCGATCTAGAATTGATGAGGATCAAGAGTAATGTGAGTCAACACAAAGTTACAGATTTTGTGATTG
GCGGTGATGGTATATTGAGATACCAAGGTAGACTATCTTTTCCTGATATCGATAGGTTGAGGGAAAGAAACTAGGACGAGGCTCGTAACTCCCCTTATGC
TATTCACCCCAGTTCCACAAAGATGTATCATGATTTTAGAGAGTTCCTTTTGTGGTGTAATGTGAAACATGATGTGGCTAGTTATGTTGAAAAGTGTAT[
G/T]GTGTCCACCAAGTGAAAGTTGAGAACATAAGGCCCGGGGGCTTGTATCAAGAGATTCCAGTACCCAAATTGAAGTAGGAGGTAATTAATATGGATT
TCATTACCGGTCTTCCTCAATCTTGGAATCAGTATAATTCTATTTGTTTCATTGCTGATAGCATGACCAAGTCCATCCACTTTTTTCCCATGGGGACAAA
TTACTCTGTGGAAAATTATGCTAAGTTGTACCTTGCATAGATCGTGAAGCTGCACGGTGCTCCAGTTTTGATCATTTCAGATCGGGGTCCTTTATTTTTA
TCCC

chr06 96,510,975 C C A
TGCACATGGCCACTTATACCA
TGTGGAAGGTAGCGATCCTG
21
20
21
59.18
83
AATAATGTCATTTATAAAACCAAGTAAAACCATCCTTATGAACACAACCATACATATATATATATATATATATAACCATGCCATAAAAGGTAATCAGGTT
TAGCTTGCCATTAAAACCTTTACCTAGGCTTTGTAGCTTTGCCATCCTAAACCACCCATGGGCTATATGGGTTCAACTCCCCCTACTGAAAGGGCCTCAG
TACATAAAGCATTACGACCAGGGAAAAAAACTGGGATGACTAGTACATCCCCCAAATATATTATGACATTATGCACATGGCCACTTATACCAAACCTCA[
C/A]ATCAGCATATATGAGTTTCCAGTTTAGATACCTTCAGGATCGCTACCTTCCACAACTTTGCTACACCTCTATCCTTTAAGCCCAATTAAAACCATT
TTCCATCAAAATCATTATTCCATTATTTTTAGTTGAGGCTATTAGTAGTGGTATCGTCATACCAATAATAACTTGCAAGTATGGTTCTTAGCCAAACCTT
AAGGGATTCCATGTACCCCACATGATTTCCAATTAACCAAAACCATGACCACCAAGGCCTTTCCAATCCATTTAAAACCATTTAAAAAATTCATACCATT
TAGG

chr06 107,500,038 A A G
ACCTCTTTTGAGCCAAACACA
TAGCTGCTCCTCCCCCAATA
21
20
21
59.73
90
TTAATAAAAGATAGCATTAGGCTATATGTCATAAGGCTTTGACTTCATCTTATTTAATGAGTCTATCTAGAACAATCGTAATTTCCATATCAGTATTTAA
AGGTGTTGTGATGTTGGAAAACATTATATTAGGCTTTTAATTGTGAGTGGGCTTTTAAATTGACCAAATAAATATCCCCTTTATGAGTTGAGTAACCAAT
TTTTGCCCTATTTTATTCTTGAAATCTATTTTTTGAATAACCTTATTATAAGTCATAACCCGTCTTTTACAATTACCTCTTTTGAGCCAAACACATCTT[
A/G]GAGTATCTATGTGAGATTGTAAACTAACTTAAGTCAAAATCCTATATTGGGGGAGGAGCAGCTATCAGGAGATATTTGTAATTTGAAGTTCGTAAC
CTTAGGGACCATTCAGTTCGTCTTCTAGTCATACTAGTGCACGTTCTAAATAAATAGAATAAAAAAGAAGAAAAAAAGACTTGCAATTTTGAACTTAGCG
TATAAATATTTAAAGAAGTCTATCTTTTAAAATGATATGGGGAGAAAGATGGCATGAGAATTTTTGATAAATGGTCCATGGTATGCAATAAGAAGTAAGC
TTTG

chr06 119,000,032 G A G
TGTCAACTCTCAGGTTTTTGGT
TACCACGAAAGCAACCACGA
22
20
22
59.9
89
AAATGTCCAAAATGACTCTTAATGAAGGGGCTCCCTTCAAGTATAGTTCTAGGGAAAGTTTTATTATTTTTTAAGTCCTCCCTTCACACTGCAATAATGA
AATCCCTTTGGTGGGATATTTACACACTCTAACACATCCATCATCGTGGTCGTACCCATATCAAAGCCAAATGTGTTTTTAATGCCAAGATCGTGCCCAT
GATTATGGTTTCTAGAAATGATTGTGGTTCTATATGTTTGTTGGAAGGTATACTTGTCAACTCTCAGGTTTTTGGTATTTTTCATGTAGATGAAGCCTC[
G/A]TAGGGTCATGGTTTCTATCCACATCGTGGTTGCTTTCGTGGTATCTCACTACTGGACTCCACTAAAGTAGCCATAAATTATTTCTCCAATAACTAA
TTAAGACAAAACCGGATGCATTGGAAAGAAGACTCAACGATATTTCATTTGATGGGTCTTTAGCATAAAAATACCTCAGCATCTGGTAATTATGCTTATT
TAAAGGTGACTATAGCAAGATTCTTCGCAAGAAATCAATCACTATGGAAAGTTTCAACTTGGTTGTGAGCTAGGAATTACTTGTTGTTTTAATACATGTA
AAAA

chr06 149,002,784 A G A
TACACGGTGCTTGAGGCTAC
ACCCTGTTGATATTTGAGGGT
20
21
20
56.6
113
AGATCCAAAGAAGTACAAAATCACCTAATGCTGTATAAGAGCAACATAAAAACCCTTAAACCCTACATCATGAAACGATGTAGCTTCTAGGGATGGTCAG
TGGGGTGAGCACTAGCATGTAATTCACTGTATAGGGATAAAATATTGCTATTACGAAAATACAGTCATAAACCACATACACCACATTCATATATGTAACG
CCCCAGAAAACGGGTCCCGGAGCGTTACACGGTGCTTGAGGCTACGAGTATCCCCAAACTAACCCTTTGAGCCATTTTCATTCAGTTCAACACAAATCA[
A/G]CGGGGTTTTCATAAATAACCCTCAAATATCAACAGGGTAATCATCATCCAAGAATAAAAGAATTTCAGAAAGATAACAAAATATGACTTATTAGTC
AACTCCCAACATCTATACTAGTCTGACAAGCCTCTAAGAAAATCAATAAAACTAGCGAGCCATTGAGACATGCCCCAACTGACTCATACTCTGTTATCAA
ATGTAAACAATTCCGACCAACATCAGACATCACGTCCTTGGAATATGAGGACTCACTACAACAGAGGATGTAGAACAGCATGCCCAAAGAATCACTGTCG
AATC

chr06 157,500,220 G T G
ACAAACATGCCCATGACTGC
TCAAACTATGTACTAAGACCAGTT
20
24
20
55.25
114
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCTCAAAGAAAAGAAAAGAAATTTTATAATACATGATAAGAAACATTCAAAATCCATCG
CATTAGAGTAGTTTAACTAAACAAACATGCCCATGACTGCTAATTAAGTAAACACACTTGAGTTTTGCAGGTGTGTGGTGTGTCCATAGAGAACAGTTG[
G/T]CAAGACAACTAACTGGTCTTAGTACATAGTTTGAAGATCAATTAAGAGAAGAAAAAACAAGATTTAATTTATGTGCACTAACTATATAATTATTTT
AAAAATTAATTTATTTTAATTTATTGTAGTATATAGTTAATTTGCTTTATTTTAAAAATAGATTGAAGATGAATAAAAGAAGAAAACAAACATGATTTTT
CATATAATGAGTTTACAAAAATCTATTTTTTGTTTATATTTTGAATGCACCTTAAATATTTACTTATGAACATAGTTATTGTTAGTAATAGCATATATAC
TTTC

chr06 173,141,071 T C T
TACAAAACCAGGTCCCCGAC
TGACCTACTAGATCAACACCA
20
21
20
55.44
90
AAAATTAGCTTTGAATTTTTTTCTTCTTTTTTGATGCTTGGTAAATATCAACCAAGTATTTGGAAGTACAACAGTAATGCGCATAGTGTCCTTTTGCACC
GCATAAAAAATAAATACATGCTCTAGCCACTTCACGTTTCTCAACCTTTCGTTGTTCCTTTTGACGGGTCCTTTCCTTGTTGAATTATTAAAACTAGAAA
CATGATTTCTTTCTTGACCATAATCATGATCATGACCACGTCCATATACAAAACCAGGTCCCCGACCTTTTCCACGCCTAGCATGATTGGCGTACACCT[
T/C]ATTCACTTCTGAAAATGGTGTTGATCTAGTAGGTCAATTTTTATGATTTTTCATTAATAAATTATTATTTTATTTAGTCACAAGAAAATGAGAACT
CAGATCGAAATACTTTTTGAAATCTTTCTCTCGATATTGTTGTTGTAAAAGTACATTCGAGGCATGAAAGTTAGAGAGTATTTTTTCCATCATATCAACA
TCAGTAATAGTCTCTCCACATAGTTTTAACTACCAAAAACTTCTGAACACGGCAGAATTGTAATCATGCACAAACTTATAGTCTTGAAGCCTCAAATGCA
TTCA

chr06 183,004,079 G G C
ACATGGTGGCTGGTTTATGG
GTTCGGGTCAATGATGCAGC
20
20
20
59.9
118
AAGTATGTCTCCTAATAAATGTCTCTTAACCCAAACAAGAAAGTGCATCTCCTTACAAATGTTGCTTGAATTACCCAAATAAGGAAGTGTGTCTCCTAGA
GATATTGGATTTCGAGTTTTACCATGAATTTGAATACCAAATCTGTGCAGAAACATTGCCTCTTCTATTTGTAGAAGTGAGAATATTACAGCCTTTGATG
TTTAGGCTTTGAAATCCTTGATTTGTAGGTAGCATGTGTTCCTGTTTCATACAAAGAAAACTTGTTAGTTTAAAAACATGGTGGCTGGTTTATGGCTTT[
G/C]GCTTTCGTGGAAATCTTTCTTGCCCCTGTCACATTTAACCTTGCTTTCAACCATTAGCATGTGTCACTGACTTGCTGCATCATTGACCCGAACTCA
GATTATTAAGAGTGACTCTGAAACAAATACAATATCTCTGCTTTGTCATGTTTCTCAGATAAACCCTTTGAACCTTGGTATTTACATGAGTTCATAGACT
TTTCTATTGATAAAACTTTATACATGCCTCGTTCTGACTTGCAATCTTGTTTCTTTCATGTGCTGACCCTTTGTCTTGCTTTGTGCATTGAAGAAGATGA
TATC

chr06 193,500,050 T G T
TGGCATGCTACACACCCATT
AAACACCGTGTGGCATTTGG
20
20
20
59.9
134
CAGGGGATCTGCCTGAATGGACGGAGGTGCTAGCTTATTTCCTGTTCTTCTTTCGTTGTTCTTTTTGGGAGGCATGTTCTATAAATGGAAGTAAGAAAAG
GATTAGACTGAGAGTATATCTTGAGCTCATGCTCATTCGCACGATATGAATACTGAAAGAAGGGAAACTTTTTCTAAAATTGCCTCATAGCCTCTTGTCC
AAAGTTTGGCATGCTACACACCCATTCACAAAACCCTACTAGACGTGGCTTTTAGACTTCCTAGGACTCTGTTGAACCTTAGGCTCTAATACCAAGTTT[
T/G]TAACATCCTGAGTTTGCACCCCAAATGCCACACGGTGTTTACAACTCTGAAGGACCATAAACTAACCCATGACTAATATCTTCTATGAGCACTGAG
TAATAATACTATAATAAATACAAAAACTAGGCTAAAATGCCATAAGGTTCAAAACCCAAAATAATGATAAAGAATATCAACTGTAATTATAATTTGTACA
ACTGAATACTATTTGAAAGTCTAGTCTAAAAGCCTCTATCTGTCTGAATATAGAGTTGATGGGACAAGTCCCCAACTAACTCTGACTACTGAAATAAACT
GACT

chr06 194,000,086 T C T
CCAAAGTAAGGAGTGAATGAATGT
ATCCTATGGAAGTTCCCGTT
24
20
24
55.9
144
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACTTTAAATACCACTTGTGTATATATGTAGAATATATGTGTACATATGTTTGTTA
TGTTTATTACATAGTGTAAATTTTAATAGAAATATATTAAATATTAAAAGTATTTAATTCAAAGAAGAAATTTAATTTAAATGAAAAAATTCCAAAGTAA
GGAGTGAATGAATGTTGTATTTTATTGATTGAAAAATGATCCAAAACTTATAATTTACATGAATGAAAAATTAGAAATTTCGCATCATTTTTTTCAACT[
T/C]GTTCATTTTAATATTAACGGGAACTTCCATAGGATAATCAAAATCAATAGGGGCAAAACCATGCATTGGACTTGATTGTGTTGAGTTCTCCCTTGA
AGTTAGAATTTGTTCAATATTTTGTTCGTCTTTCGGTCCCACCTCCATTTCTTCGTTTCTTCATTTTTCTCTAATTCATTCTCTAAAGCAAACTAGAACA
TTCATAGCATTGCTTCCAACTGAGTGTCGATTGTCTCCAAGCTGTTGTCGTCCCTGACTAAAAGCGCTCTCCGATACAACGATTGACATTGGAACATTCA
ATAT

chr07 17,500,008 C C T
AAGGCTCACAAATTTACTCTGA
TGTTTTCAAACCATGCTGGCT
22
21
22
59.24
117
AGCACATCCTATTTCTCCAGAACTACGAGCCAACGTAGGTATAGATTCAGATTATTTCTATTTCTATATGGATGACATATTATGATCACTTAGCTTAGGT
TATACTCCTTGGCAAGAGTATGCCACTTCTCCCCAACATGAGGTTTTCCTCTTAGGGGAACTAGACGTCGAACTCCACGATAGCTCACATGGTTTATGTA
AATTAGAAGAGCTCCCTAACAAAAAAATAATAATAGAATAGTTTTAAAAAACTAAGTGTAAAGGCTCACAAATTTACTCTGATATTGTCTTACATAAGA[
C/T]TTCAGTTATCAGATTTTAGTTTTTTCATATGATAAATGTAAGTCCTTTTTACACTTAGCCAGCATGGTTTGAAAACAGAATAAGACTACAAATTTT
TAGAACTAAGTGTGGTGGCTCACAGAATTACCTTTATACTTTACTTCTCATGATTTATGATTTTACATTTTTGATTACCCAAGCCAAGGTGAGTCACTTA
CACTTAGCATGCAGTTTTTTTGACAGTTTGTATGAATAGTGCATTATTGTTTTACTCATGCATTCACCCCCACATGCTCATTATATTCCAAAATTATTGA
TTCA

chr07 28,000,117 A A G
ACTGCTTCCTTGAAACACGT
CCTCTTTCAAAGTGGCCTTGC
20
21
20
60
137
TATGTAGTTAGGAATTAGAGTTTATAATTCCTAGTTATTGAGTTATAAGGATTAGAGTTTATAATTCCTAGTTGTTGAGTTATAGGAATTAGAGTTTATA
ATTCCTATTTGTTGGTTACAAGAGTTTTGTAATCAGTCGTTGTTGAGGCTCAGAGTTTTTTAGTGAAGTTGGGGTTAAATCCTGTAGAGGTGCAGGTCAT
GGTTTTTTTACACCTTTTGAGTCAGGTGTTTTCCATGTAAAAATCATTGTGTTCTTCACTTTTTGTTTACTGCTTCCTTGAAACACGTTAGAGGAACAC[
A/G]TCAGGTAACACGTTCCATTGATAAGCAAAAGTTAGGCAAAAATAACAAAATCAGTAGGGCACGAATTCTTAACAGTGTTTTTTTGCAAGGCCACTT
TGAAAGAGGCTCATGGAATAGATACAATGACTGGCTGATTCCAATTTGGATGACTGTCTAATGGGACAGTGGATTCTGAAGGAGACTAAAGGAAGATCAT
TTAAGGCCCAAGTGTTAAAGTTAGTAGGAAAAAATACATAAATTAGCATACTTAATATTAAATTATAAAAAATAACAACACTTTTATCAAATTATATTTT
GTAG

chr07 30,501,804 C A C
AGCCTCAAATGGATCCATCTGA
CGGGCAGAGAAGACGATTCA
22
20
22
59.83
150
ATAGGTGAGATTTTCAAATACATGAAATCACCAACCTCAAACTTAAGGTCTCTTTTCCTCTCATCTGCATTAGATTTCTGATGGCTTTAGGCTATATTAA
TCTCTTCCTAATTAGCTGAACCTTCTCTATCGCATCAAACACTAAATATGTCCCTACCAAAGTGGACTCACCTAACTCAAACCAAACAATACGAGATCTA
CATCTCCACCCATAGAGAGCCTCAAATGGATCCATCTGAATACTGGAGTAATAACTGTTATTGTAGGCAAACTCAATTAAAAGTAAGTGGTCATCCTAA[
C/A]TTCCCTTAAAGCCAATAACACATGATCTCAACATGTCCTCTAGGGTTTGAATCGTCTTCTCTGCCCGACCATCTGTCTGAGGATGAAAAGCTGACT
AAGATAAACCTGGGTACCAAGACCCTTCTGAAATGCTTTTCGAAAATAAGAGGTAAACTAAGTACCTCTATCTGAAATGATAGACAATAGGGCTCCATGC
AACCTAACTAACTCTCTAATATAGAGCTTGGTGTTATCCTCGGCTGAATAGGAAGTATGAACTAGCAAGAAATGGGCTGATTTGGTCATTTTGTCTACAA
TAAC

chr07 74,000,026 A C A
TTGATTTCGAGACCAAGGAAT
TGAGCACATAAGGCTAGGAGG
21
21
21
58.96
111
CTGAATAGTTCTCTCCACTTGCCTATCCGTTTACGGGTGGAACGCAATACTCATACTCATATTGGTCCCCAGCCTTTTCTGAAAAGATCTCTTGAAGTGT
GATGTAAATTGGGTGCCATGATAAAAAATAATCAAAACAGGCACCCCATGCAGCTTCACAATCTCTTGAAGGTACATCTTCACATAATCTTCCATAGAAA
AAGTAGTTCATACCGGAAAAAAATGTACAGACTTATTCATTCTATCAATGATAACCCAAATTAAATCATATTGATTTCGAGACCAAGGAATATTGGTAA[
A/C]AAAAAATCCATATTGATCATTTCCCACTTCTATTAAGGAAAATTAATTTCTTGATATAAACCTCCTAGCCTTATGTGCTCAACCTTAACCTGTTGA
CACAACATGTACTTGGCTACAAATTCAGCCACATCCTTATCCATGCCATTCCACCAATAGATCTACTTGAGATCATGATACATCTTAGTCGAGCCGGGAT
GAATAGACTCATGCACCCCAGCCAAAATTTTTTATCGCAAACCATCAAGATCAAGAACGCACAACCCCCTTGGTACCGTAAAGTACCATCACCATTGATC
CCAA

chr07 78,002,404 G G A
GCCTGAACCCTGGGCTTTAA
GCCCATGCGCATATGTAAATGT
20
22
20
60.03
145
TAGGATGGTAGCTTTAAATCACTTAATTGGATTATTACATCCCCTCTCAATGATGTAGTTGTAATGTCCAAGTTAGGTAAATGGTTAGAGATCGGGAGAC
CATGATAATACGACTAACCCTACGAATCAATAACCAAGATAAGCAATTTAACGAATGAAGTTCAATAGCATTGTATGATTGTTCGTAAGCCTGAACCCTG
GGCTTTAATCCATTGATTTTCCTAAGTCATTAGTTTTCCGCATTAGTTTAGTAACTTTTAGTTTATTTTTTGACTTTCTTGAAGGCCACTACATTACTT[
G/A]GTAGACCACGTACATTTACATATGCGCATGGGCGCTGTAAAGTTTTTGGCACCATTGTCGGAGACTTGTAAATTAGCAACTATCTTATTTTTAATA
TAGCTAGATTAAGTTGCAAATATTTTAGTAAGTTTTATCATTTTTTTTAGTTTCTTTGTTCTTTTTTATTTCTCACACTTCTTGAGATATCAGCCTAGGA
TAGATAGTTTTTGAGTGCTAATAATTCTTATTAGTGTATGGTTTGTGGCAATAGTAATCATTCTTTAGATGTATGTGCATTCAACCCTAATTTAGTGATG
TTTG

chr07 79,501,184 C T C
CGACACTGGTGGAGAGGTTA
CCCTGCTCCAACCTTGAGAA
20
20
20
59.6
148
CACATATCTATTAAGGAGTAGAGCATTCTAGTTAGGTTCTTGAGTTTGACTCTAGCTAGGTTTTTCGGTGCACCATGTGAGGATGTTTATGTGGTCTTTG
TTGCTCGTTCGAATGGGCTCCATAATTTAGGTCCATTTGAGAATCTTGGCATAGAAGACACTACTTTTCATTTGGATTTGGCATCGCGACACTGGTGGAG
AGGTTATCTTGATTCCAGGACAGCTAGATCTCCTCTTTGATGTGGATTTAGTTTTTTAAGATTTTCTTTGAAAATTATATGCCTCACAGTCTTAAATAT[
C/T]ATTTGAGAGACAAGTTCTCAAGGTTGGAGCAGGGCTCTATAACTATTGTAGAGTAAGATGATTGGTGTTATGAGTTGCCTAGGCATGCTATATCTA
CCTTGCCGACTGAGTATGAGCAGGTTTAGTGCTTTATTTAGGGGTTGAGACTTCTTTTTTGCATGACAACATAGAGTTTGGTTGCTACTGGTAAATCTTT
TTTTGAGGTTTTTAATCACACATATGTTATTAAGGAGATGCATCATGAGGCCCAATGAGGCAGTGATAAGAGTCTGCGATACCAGGGTAGTTTTAGTGTA
AGCC

chr07 93,500,100 A A G
CCCCCAAGATCATTTGGCCT
TCCTCGGGTTGGATGAAAGC
20
20
20
60.04
147
CTTCGTGACACGGAAAAACCATGGAGTCTCATTCCTCGATATTCCAAAATTGCATTGAACCCTTTCCAAAAATTTTGAAAGCTTTCCTGAACACCCTTTT
AAAATCCCTAAACACAATTTAAGTGAAAAATTGATATTTCAAAAAAGGGAAGGTCAAAATAAAATGATGGGAATTTTAAGGGTCTTACATTATCCCCACC
CCCCAAGATCATTTGGCCTCAAATGATAAGTTAGGACACTTTTAGCATGATAATAGCAAGAATGCACCAGAATCAAATGACAAACTCATGGAATGACAA[
A/G]AGAAAAATGAAACTCATACCTTAAGTGCTTTCATCCAACCCGAGGAGCAAGAATGGATATTTAGCCTTCATATCTTCCTCAGTTTCCCATATAGCC
TCTTCTATATTTTGGTTTCTCCAAAGGACCTTCACCGAAGCTACATCCTTGGTCCTCAATCTACTAACCTGCCTATCTAATATCTCAATTAGGACTTCTT
CATAAGACAAGGAATCTGCAACACTAACATCCTCAACCGGCACTATTAAGGAAGGATCACCTACACACTTTTTTAGTAGGGACGCATGGAACACGGAATG
AATA

chr07 97,002,296 G G T
GGCGGTGCCTCTACTAAACC
TGGTTGAGATGGATGAGCGG
20
20
20
59.82
120
ATCAATTGAACTATCTGGTAACTAAACTGTCATTTCTAGTGGGTCATAAATGATTTGGGGAAGCTATTGGAAATCTCTAAATGGTGAAAATGAGTAGAAA
TATAGAAAATGTTCTGGTGAGTCATTACAATATCCACTACTATAAGAACTTTTGTCCGCAAAAGTAAAGGGTTACGATGTACTTGATGCCTTAAACAGGT
GAGGATACTGGGTATGCATCTTGCTTTTAACCTCCCAAGTAGTCTTCTCTACTAGGCGGTGCCTCTACTAAACCTTAACTACTGGAATCTCTTTAGTGT[
G/T]CAACTTTCTGGCATCACTAGCCAATATGAGCGTCGGCTCTTCCATGCGGGTCAACCGCTCATCCATCTCAACCAAGTTGTATCTAAGCATGTGAGA
AGGGTCAGAAATATGTTGTTACAACATAGAAATAATGGAAAACCAAATGGACGGCAAGGAAACCTAGGCATAAGGCTAACTCATAAGCTACCTCCCTAAC
TGTATGGAAAATCTCAAAAGGTTGATTATATCTAAGGCTGAGCCTTCCTTTCCTCCAAAACCATATCACACCCTTTATGGGTGATACATGGAGGAATAAT
CGGT

chr07 125,501,249 A T A
TGGCAACACTTCACTTTGAA
TGCTGTAGAGAGAAGGGTACA
20
21
20
57.55
127
GAGATCAGTATCCCTCACTACTAGAAAATACCTCTATCACAATTAATGTTTTTTTCAACGGATGGCCAGGCGCTGCGATAGAGGACCTATTGTAACGGTT
CCAACTGTTGCAAAAAAATGTTCTAGTAGACCTATTTAGTAGTATAACCATTGTAGTTGTCGTATAACCATTACATTGGACTATCCTATAGCAACGGTTG
ACAAAACCGTTGCTATAGAGTTAGCTATGGCAACACTTCACTTTGAAAAAAGAAATATTGCATCGGTTTTATCTTATATATATTTATGTCTACAAGTGC[
A/T]AAAAGCGAAAACCATTTCTAAACTTCACATTGTTGTACCCTTCTCTCTACAGCAAAAAGTATTGGTGTGAGTAAAATTGAGCTCTATTTCTCCATT
TATGTAAGAATCAGATATACCTTCAACCAATGATTTCTCTATTTACGTAAGAATCTCCATTTATGTACTCACCAGAAGCACAAATCAACCATACACCACT
GCAAAAAGTGATTTCTAAGCTTTTGTGACCACCTTTGTTCCGACCATCACATCAATTTCTGATCAAATTTGGGGCTTTCTGCTAATTTGGTAATTTTAAG
GTTA

chr07 160,505,171 T C T
CAGCCTTGGCATTGGTATTGG
ACCCAATACCGAACCAAGGAC
21
21
21
60
150
GGTTTTATAAATGGCATTATTTTATCCTTATCCTTATTTCATGCTAGTGTTCACCCGCTAACTCATCTTCAGGCGGTTGTATACCCACGCTATGCAGGAA
TCGTAATTTTATTCCTCCTACATAGTGATTGACTCGGGGACAACTTTTGGGTTAAGTGGTAAGCTTTCATTTTTTTGGAAGGCTCCATTTCATGTTATGG
ATATTTTTAGATATTTTGATTTATTTTTGGATATTGGTGTCAGCCTTGGCATTGGTATTGGTATTAGGGCTGATACTAATTGACGATATTATTGGTTGT[
T/C]CCATCATATTTCATTTTACGATTAATCATATTATGTATTGAATCTCATTTAGTTATGGCCAGGTTTATAGTCCTTGGTTCGGTATTGGGTTGGCTG
GGTGGTTTGGTTGGTATAATTTGGTGGATGAGATGACTTGGTAGGGTGTTGTTCTAGCAATAGACCTATCCCAAAGCTAGTCCTTGTCTAGTTATACTAT
CTTGTTATATGTTCAAAATTTAGCCACCTCAAGGCAGGCGCTGGAAATTAGGTTGGGTAACGAGGGTAGCCCTGGGTCCCAGTCAAACCTGGGATGCTTA
TTAT

chr07 167,436,159 C A C
TCTCGACTAGAGGAGGAAGCT
TCTTGGGAAATTGCAAGTATTTTC
21
24
21
56.41
95
TGATCTACGTTGTGACAGAACAAGATTTTTTGGTAGTGGTTGTTGCCTTTGAGATGTTTAGGTCTTATTTGATTTGTACTAAGGTGAATGTGCACCCTAG
TCATGTATCATTGCGGTACTTAATGGTGAAAAAGGATGTGAAGTCTAGACTAATTCGGTAGGTGATATTGTTGCAAGAATTTAATTTTGAGGTCAAGGAC
AAAAAATACACTGAGAATCAAGTTGTAGATCATTTGTCTCGACTAGAGGAGGAAGCTATATAGAATGTTGAAGATGGGCTTGAGATTGATGATAGTTTT[
C/A]CAAATAAGAAAATACTTGCAATTTCCCAAGATATAATTCTATGGTTTAGAGACTACAAAGATTATCTAGCAAATGATCTAATCCTAGAAGATCTTT
TCTTTCAGTAGAAAGAAGTTTATGCATGAGGTTAGGAAATTTTTCTGGGATGCAGACGGGATTATTGGTAGATGCATACCTGAGGTAGAGATGATGAGCA
TACTTGAGGCTTGTCATTCTTCTCCAGTTGGGGTCCATCATGGTGGAACCCGCACAACCCACAAGATCTTGCAATATGGGTATTACTGGCCAACAATCTA
CGAA

chr07 175,000,322 T A T
TGCACAAGTTGGGGGTTCTT
TGAAATCAAGGCTGGCCCAA
20
20
20
60.18
150
AGACACTATTTTCACTCTTTTTTCATATCAAATCACACCAGTAAACTTAATTGATGATATCATTGGACCAACTGTTTCACTCATACCATATGCATAGTTA
ATATTAAATTTAATTTTTTTCACAGTCTGATCATATTCATCACAAAGTTCAATTCTCTTTTCACCGGTCCTCTTCATCACAATATATTGCACAAGTTGGG
GGTTCTTTCGTACCCTCCAACTTGAGGGGATATTGAAATATTGTTGTATTTGTTCATTGGACCGGGTTGATTCACCTGTTTCATCTCACTATATATTCG[
T/A]CTGTTGCAGTACAAAGCTTGGGCCAGCCTTGATTTCAGTCGTCTCAACATGTTAATTTCGGCCCAAATCTAGAAAATCCTTATATATTATTTTATT
CCTTTTGTATACCTAGGTAAATCTTTAGTATATATCTCCAATATCCTGTAAATCTTTAGTATATATCTTCAATATCTTGTACCTTGTTTAGGAATGTATC
TGTTTGTTATTTTGTACCTTAATTAGGCTTCTAGCTTATTTAGAATTTTAATTTTAAAGTCGGTTTAGTATTACTTTTGTTTAGGATAATTTCATTCTTT
TACT

chr07 194,509,018 C T C
TCTTTAACCCGGCCAAGTGA
GAATGGGAGGGTGGTTTCCT
20
20
20
59.3
91
TTGCGTGTGAACAACACTGATGCACCCCATGGGGATACACTAAGATGAATAAACCCCTTATCCAGAAGATCCTTAAGGTTCTCCTTGAGTTCCCTCAACT
CAGTCGGAGCTATTCTATAAGAAGGAATAGATATTGGATGAGTTTTTAAAACTAAATCAATACCAAACTCTATTTCCCTATCCGGAGGAACACCGGGAAG
ATTATCTGAAAAGACCTCACAAAACTCATTTACTACCAGAACTGAATGAAAAGGACCCTTCAAGTTAAAATCTTTAACCCGGCCAAGTGATAAAGACAA[
C/T]CTTTGGAGATTAATCTCCAAATAAACCTCCTCCTAGGAGTTAGGAAACCACCCTCCCATTCTATAACTGGTTCATTAGGGAACCTAAAGACATCCA
TATAGGTTCGATAATCCAAGGACATGTAACAAGAGTGTAACCAATCCATCCCCAGAATAACGTCAAAATCTACCATATCTAGCTCAAACAAATCTAAGAA
GGTTTGTTTGCTACCAACAGATACCACACACCCCTATAGACTCTCCCAATAAAAACCAAGTACCTACCAGGATATAAATAAAAAAAGGATCCAAAACAAC
CTTA

chr07 202,011,634 C C A
ACTTCTTCACCAGGTGTCGG
TCCTAGAATGTTAAGAGTGGGCT
20
23
20
58.64
147
GTTATGACACAGGAATTTGAATTATGGATTAATAGTATGGCAATTACACCTTCCCTGCGACATGGTGAAATCGCGTTAAGCTACTGGAAAAGGACGAGTG
TGAATTTGCACTCTAGCGCGACGCGGTGCTATCGCATTGCACCACTGAAAATTGATAATTGGGAATTTGGACCTCTCTATGATGTGCCAATATCACAGAG
ATCCACTGGAATGTGACGATTGCCATTTTGGCATCCACCGCAGGTGGGACATTGCATTACAAAAATGCACTAACTTCTTCACCAGGTGTCGGATTTAGG[
C/A]GAATTTGATATCAATGGAAAGCTTATTCAATTTTCCATACAATGAAAGGTCTAAATCTGAAAAATTCTATATGAAATAAATGTTATTCATTTTTGA
AGCCCACTCTTAACATTCTAGGAACAAATTTTAAGCTAGGAAAAAACACGGGGTGTTACACGATCATGATGAAAATGATGTTGACAGTGCATTAATTTTA
TATTAACATGCTGGAAAGTACAATAATATGTAGAAATTCGATGTTAACATATTCAAAGCTTTAACATTGCTGGAGTTTATTTTAATGTGCAGGGATTTAT
TACT

chr07 220,504,434 G G A
ACATGTACAACGGAAGCAACA
CCTGGAGGTCAAAGCAGTGA
21
20
21
59.6
141
GCTCATTATCAAAAGAATTTTCACATGTTTTACCAATCAAAAGAATCAAACTCACACTTATGATAAAATGTGAAAGTACTTACCATTGATACGATAATAA
GCATCCCAATTGCTAAAACTTCTGCCATCTTCAAAATATCCTCCTTCAATCTAACACACATAAAATTGCAAAATTAGGTAGTTACAATTGTTAGAACATG
TACAACGGAAGCAACAATTCTACAGGATCAATATAACTTACATATAATCTAGATAACATAAATCTTCAAACGAAATTGAAAAGCTACTTACCTATTGAA[
G/A]CTTTCACACAATTCGTTCACTGCTTTGACCTCCAGGGCTTCAGTCTTCTACTGTATCCTGACTAAATTTTGCTATCAAACTTGTGTGAGCAAGTGC
TTTTTGGATTCAAAGAGAATGATCAGGAAAAAAGATAATAATCTTCTGAGAAACACCCCTATTTATTCTTATTTTCACTTAAAGAGGGTAAAGCCAAGAG
GCAAATGTTTTTACCCCTTTAGTTGTCCAAAACGTTTTACGCCTTTTCAGTTATCCAAAACATTTTCAGCCTTTTCTACTGTCCAAAACGTTTTAGGTCT
CTTT

chr08 1,004,445 C C A
TTGCCAAGAAGGAAATGCGC
TGGTGGTGACGATCTCTCCA
20
20
20
60.25
99
TCAAAGGAGCTACATCACATTTTCTGGACCCGGTGTGACGCGGAATGCACTGGGCTGTCCCCTTTTGTTTATTTTATGTCCATGTTCTTAGAGATGTCGG
TTATCCTATTCATTTTGATGCATCTTTTGTACCGTTGTATCATTTTATCTTTGATATAAATATGGTTTTGGTTTGCGAAATTCAACTGTGTTAGTGTACA
CAGGGATCATTAAGAAGAAAGAGAAATGGGGTTGACATTCACAAAGCTTTTCAGCCGGCTATTTGCCAAGAAGGAAATGCGCATCCTCATGGTTGGACT[
C/A]GATGCAGCTGGTAAGACCACCATATTGTACAAGCTCAAGCTTGGAGAGATCGTCACCACCATTCCAACTATTGGTATGTACTTTACTTTCATGCAG
CAAAAATACTTGGCAATAGCATTTCTGGCAATTGTGACTCAAAAAGACTAACCAATCATTTTGATAAGGAGATGGAAAGTTGTGCATAGAGCTAGTAATA
TAATGGTCCCTCTACTTTTTACTGTTTGCTGCAATGGTTTGGTTTGCTATAACTTAGTAATCCTTCATTTGTCTCTGTTGTTCTTCCTGTTGATCCAGGG
AAAG

chr08 5,000,738 T A T
ACTGGAAACTATCTGCTTGGT
TGGAACAACCCTCCTCAACG
21
20
21
59.89
148
TCTAAGAACGATTAGGAAACTGAGCATCGAAACCTATGTTATAAGACAACGTAGTGCAATAGAAAAATATATAGTGAGTACTTGAAATGTAATGGTAAGT
GAGGTAAGGACTAACTAAAATACATGCAAAAGTAAGTAAAATCATTTCAATATGTAAAGCTGAATGTTTAAGACCAAGTATATTTAACACACTATCATTA
TTTAAGCAATTGATACAATTTATATAACTTACTAAATAAATACTGGAAACTATCTGCTTGGTTCAATAAAGCTGAACTAAAAAAGACAATCCATACAGA[
T/A]TGAAACTATGGGAGCTATTATAACTGACATAAACCATGGTTAGTACCATGGAGTCCAACGCCTGACCCACGTTGAGGAGGGTTGTTCCATCCTTTC
CATTTGAGTGGAACCTGAACTGGATTGATCAGTATACTTAAACTATTTGGGCAAAGGGAAATGCTTTATTGTGAATCCCAAAATCCTATGAAGGCACGTA
GTTTCTGGGAAGTAGGATGCATTGAACCCACATTGTTCTCTCGATGCTAAATCCTACTCTGAACTGAATTACTATGGTATTATTCATGGTTTAAGATAAC
GTGG

chr08 17,000,733 G G A
ACATGGTTAATCACATAGTTTGGC
ACTTGAAGAAATATCTTGACCCTC
24
24
24
56.43
147
TGAGGATTTTGGAGGATTGTTACTTGAATGGTGTTCCCATTATTTTATGTGCATTATTTTTGCTTTTTTGATGGTTTTTTAACTAAAGAGTGCATAGGAA
TGGTAATATGGGATAGGGGTTGTGGCATCCCCCTATATTAATGATTTCTTGTATTGGAATTAGTTTGAAAGTGTGTAACCTCAACCCACTTGTATAATAG
TCTTTGAAACATGGTTAATCACATAGTTTGGCTTACTATCCTAAATTATTACATTGCATAAAATCTAAATAGAATACAAATGATTTTTTGGAAGGCCTT[
G/A]ATGGCCATATGTTGACTTAATTATAAACTAAGAGGGTCAAGATATTTCTTCAAGTTGATTTTTATAAACTAAGAGTTTTGAGGGATTCCCTAAAAA
AATTTTCTTGATAAATCATGGGGGTCGAGGTATTCCTCCAAGGTGATGAATAATTAGAATGGCATAATGATTTTAGCCTACAAGCGTAATTGGTATGACA
ATACCAATGGTATATGTCGTAATGGATGATTCTTGGTTAATAAATGGGAATGTGTAAACTATTTTAATTGGGATGGATGGGGGTTATGTAGCTTATCATG
AAGG

chr08 33,501,901 C A C
GTGACATCTTCAAGCGTGTGG
AAGCCTGCTGACGTAGAAAT
21
20
21
57.23
101
CTCCAAGATATGACAGTATCCTCACATATAAACACACAGCCTGTTTGAGATCGAGATTTATGCAAGTTAATTAAATACCCAGCATCAACATAATTAATAA
GATCGAGACTGCAATCTTTATAATAATATAAGATCATGTGTTTGATCCTATTTTGATGTCTCCTAGTAGGAGCAAAACTATACCTTGCTAACAAATTAAT
CGAAAAGGCTATATCGGGCCTTGTAGTATTTGTAAGATATATTTTGTCAAGTGATAATATTCAATATTTCATGTGTGACATCTTCAAGCGTGTGGAGTA[
C/A]AAATCAAATAAGTTTTCAATTACCAAGATGCATCCTTTCATGTTACTTGAAAAATATTTCTACGTCAGCAGGCTTAAATAAACGTAGAATTCAGAT
CCTCATAATCTTTCATAATAATGCGCCAATATTGTATCAAAGATATTGATGATATATCATTTCGTATCGGTTCACAATGCGACATAACATTTTGAGATCT
CATCACTTCATTATTTTCAGGTACCTGAACCTCTTATAAGGTTTCAAGAAGTGTTATGTCATGGGCTCTTCAAGAGCACATTGTCTTCTCATTATGATTA
TTTG

chr08 34,501,964 C C G
CGGGTGCACCATTTTTACCA
TGTGTTGGCCGTCATTCTGT
20
20
20
60.18
129
CCTGTGGGATTCGACACCCAATCTAATTGGGTTCTATATTTGATAGCGACTGATTATACTCTATAGTGAGAGTTGTAATTTGGGCGTATCAAATTTTTGC
ACCGTTGTCGGGGAATACAGTTGTCATTAAGTTTGTGTTTGTTAATTGACCATTGGTCCAGTTTCTGAAATTTTACTTTTATTTGTTGTTTTTGTTCTGT
GCAGGGTAGTTATTGTGTATGACAAGTACATACATATCGGGTGCACCATTTTTACCAAAACATCTGGAAACATAGTTAATTGGCAGAATGGCAAACCCC[
C/G]AAGAGGCTAAAAGACTAGCCGCTCTGGTTAGAGCTTAACTAAATCAACAGAATGACGGCCAACACACATGTTATCCTAATCCTAATGATGATGATT
TAGGGGACGATAATTTGTAAGATCCTGTTAACCTGAGACATGCAGAGAATGTGGCTGCACCAGCGAATCAAAATGTAAATAGAAATCACCCCTTTAGGGC
AAGGTAAGAGCGTCAACTAGTGCAGTTTGATCTGAATGATGATAAAGATGGAATGGATGGAGTAGGTACAATTGGAGTTATCATTCCTCCACCTCTAGCA
CCAG

chr08 37,000,594 C T C
AATACTCTAGTTTGAAAAAGCCTC
TGAGGACATGATGATTGTTTCAGT
24
24
24
58.44
120
ACATGTTTAGAATTCCCAATCCATTTAATTTACACTAAGTATAAGTGGCATGGCCACATTAACTGTAATGCCCCGATCTGTACCCCGTATACTACACGAT
GCTCATAATCCCAAAGGACCACAAGCTAACTAATGACAGGTACTTTCTGCAATAACTGAATAATAATACTGAAGTATACAAAAATTAGGGGAAAAATATT
CCATAAGGTTCAATACTGTAATAAAACTAAATACGGTATAACAAATACCAAATTTGATACATATGTCTGAAAATACTCTAGTTTGAAAAAGCCTCTAAA[
C/T]TGTCTAAAATATGGAGTTAATGGGACAAGTCCCTAACTATCACCAAACTACTGATATAAGCTGAACTACTGAAACAATCATCATGTCCTCAAACTA
AGAGGATTCACCATTAAATCTATCAACTAAATATCTGAACTGCTAAGTATTATCAGGAGCCCGCGTGTCTGAACAAATGATATAAAACATCATAACACAA
GAGAAAAGTAAGCATCAGTACTTTGAATGTACTAGTATGCAATGTAAGGTAGGCTGAAATGCATGAGTTCATGTGCATGAACAATAATGACTGAATGACA
TGAA

chr08 56,524,853 G A G
ACCACCCAATTCCCTATGTCG
ATTGGGGCTGAGAATGGTGG
21
20
21
60.03
137
GCATTCAACCTATGTCACATGCACACCAGTACATTCAAAGTACTAATGCATTTGCGCTATGGTGTCTTATACCATAGGTTCAGATACATAAGCTCCAGAG
CATCAGTAGATTCTAGGTTCAGCCGTGAAAGTTAGAAGTGTGTCCTCATCATTCGAGGACATGATAATTTCTATCTCATCGCATTACTTAGTTTATTAGT
TGGGGTTAGTCGTGTCAGATGCCTCAAATCCAATCGGGACCGGCGACCACCTCTAATACCAAACCATAACCACCCAATTCCCTATGTCGAAGGAATTCC[
G/A]AACATATAACAAGGTTAAACAATTAATAGTCAAAGATAATAATAGAGTCTATGACCATAACAAACCAATAATACAATAAAATATCCCACCATTCTC
AGCCCCAATACCAATACCAATGCCAAAAATAACACCAATACTGACACCGCCCATGCCCTTAGTAGTCATGACATAACCCGAACTAGGGTCTTATCATAAT
GGGCATCTCAAGTCCAATAAAGACAACATACCACCCCCGTTACCAAACCCAACCTTCAAATATGCCTACCTTGAGTCGGATGAATTCAGAATGTATAACA
AGAT

chr08 64,526,579 C C T
AGCAGCTCTTGTGAGACGTC
TGAGTACGTTAGTTGTTGAACGT
20
23
20
58.33
90
TTATTATTTAGTTTTTAAAAATTTACATGTTATATTGTCTATTAGATTTAGCAGATTACAATAATTTGATCTAATTGTTATTCTTATTATTCAGTTTTCA
AACATTTGCATGTTATACTATCTAGGAGATTCTACAGATTACAACAATTGTTATAAATTGTTCGACAACTAATATGATTATTGTAACATTATTTAGAAAC
TATTATGAAATGTTCAACAACTAACATACTTGTTGTAGCAAAATTCAGCAGCTCTTGTGAGACGTCCAGCAACTAACATACTTGCTATAGCACAATTTG[
C/T]CAATTGCTATGAAACGTTCAACAACTAACGTACTCATTGTAGCAAATTTTAGCAATTGTTATGAAATTCTAGCAACTAACTTACTTGCTATGGCAA
AGTCAATTAAGATCACAATCAAATTAAATTTTACTCTTAAATTAGACTAGTATCACACTATTTGTCATTAAATATGATTGACCCATTTAATAAATCATCA
TTTAACTCAAATTTAGTTGATTACCTTTGCAATCATTTAATTGCTCATTTAGTGTATCTCAAATTACTATCTCATTGTATTTGATAACTATAAAATCTAG
CTTT

chr08 68,516,113 C C G
TGTTCAACCATATTCACGACCT
AGTGTGGAAGGTCGAAGTCC
22
20
22
59.32
131
TAATAGCCAAACCAAGTGAAAATAAGGCCAAGTATAAAGATAGGAGACCAAGAAGGAATGTATTTAAAAATAAGAAGCTTAACACTCCCAATTCAATGCA
CGAACCGTTTCAATCAGCTAATCACTATGAAGAAAGACAAGATGATGCTTCAACCCCTATGTCGCGGGGGGACATAGCATCTAAAGATGGTTAGCGGTTG
GAGCGCTAGTATATAACTCAAGGATAAGGATAAAATAGAATCATCAATAAACAACATGTCAATATACTATGTTCAACCATATTCACGACCTTATCTATA[
C/G]ATATAGGTAAATCACATGCTAACAAGTTAACAAGTCATAACAACATCCTCAAAGCACTCAATCATGAGACATGAAGTGGAGGACTTCGACCTTCCA
CACTTAGATTCAACAATTATTATTAGGTATGGGATTTCAACAAAATTCACATATCCCTTAGATGAAGGAATTTAAATATGTATACACTCATTAGGCAAGG
GAATCTTACCACATACACATTCATTCCAGAAAGGGACTCTAACCATACACTCACATTCATTTAGGCAAGGGACTCTAACCATATTCATACACATTTTGAA
AGGG

chr08 91,020,889 G A G
AGTCCAACGTTTTGTCCTCCT
GGTCCTGAGGCCGAGTTTAT
21
20
21
59.17
150
AAATGGAAAAGTATTCAAGCTTAAGGAACTAACTTATCTCAAAGCTTTATGAAAAGTGCCATAACAAGGGAAGATGCTTTCATTTAGGAAAATAACTCTC
ATCAAGAAAATACCATAGTTTTGGAATTTCTTTGAATTTCAACCATTTAGGAAAGTAGACTATAGAAAAGGAAAATAAGTATTAGATCTCGAAGTTTTAA
ATGACAAGGGAGGTTCTCATAACTGAGATAAACCATGTGAGCTACATAGAGTCCAACGTTTTGTCCTCCTAAGGAAAAGACCCCATGTTGGGGAGGAGC[
G/A]TCATACTCTTGACAGGGAGTATAACGTAGGTCTAGTGATCACTAAACAAAACTCGACCTCAGGTCCAATCATAATCATCATAAACTCGGCCTCAGG
ACCAACCTATGGTGGCACGTACTTTTGGGGTAAGAAACCGTAGTAACTTACTTGCTCGGTGCAAAATAATACTCCCTTTAGATTATCTGCGCCCATCTCA
TAAAAATCCACCTTTAGAATAATCTCATGGTTCTCCATGAACCCAATAATCAAATCAATAATCTCATATCAAATCAAATCAAAATACTCAAAACATGGGT
GCTT

chr08 93,517,654 A A G
ACATAGACTGGATACCAAGTTGT
TGCGAACCAAGTACCCTCAC
23
20
23
59.97
121
ACATACATGCTGAACATGAACAACTAAAACATGATCCCATAACTGATATAACTGATAAACTGAATATATCACACTGAACTTGAATACCTTATACAAGTAT
AACTTATTGCTAAATACATGGCTGAGTTTTCTAATGAACTGAGTTTCTCACAATGAGAATGCATATCTGATGCATGGTTATATGACTAAACTGATACATG
AATACATGACTGAATATGCAATGGTAATCGATACCAAGTTTATAATGGAATTTTGAACATAGACTGGATACCAAGTTGTAGATGAAATCTGAACATGAA[
A/G]CCTAAAAGCTTGCGAAAAACTGTTACCTTGAGCTAGATATACGTTAGCGAAGATGGGGTGAGGGTACTTGGTTCGCATATCTACTTCTTCTTCCCA
AGTAGCTCCCTCAACGGACTGATTCCTCCAAAGAACTTTGACTAGAGGAACTTTTTTGTTCCTCAGTCTACGAGTCTGATAGTCAAGAATTTTTACTAGA
ATCTCCTCATAAGAGAGGCTGTTATTAATATCTATGCTCTAAATTGGGACTACACCTACTGGGTCACCCCTACACATCTTGAGCAAAGAGACATGGAAGA
CTAG

chr08 94,024,619 G G T
GGCACGCTGTTCTACATCCT
AAAACCAGCGAACCATTGAG
20
20
20
56.91
141
TGAGTCTTTTATACATCCTGCATATTTCTTATAAATATTTATGATGATGATGTTTATACAACTGCATACACCCACATATACTCGGTTCCTTTCCATGGTA
ATGACCCACATCTTTGGATGTGGGCTGTATTTTCTCGGAATGTAGGTTTAGGTGCTCAGTTTCAGGTTCAACAGTGATTCTTCGGGCACGCTGTTCTACA
TCCTCTGTTGTGGTGAGTCCTCATGTTCCGAGGACGTGATGTCTGATGTTGGTTTCACGGAATTGTTTACATTTAATAATTGAGTATGAGTCAGTTGGG[
G/T]CATGTCTCAATGGTTCGCTGGTTTTATTAATTTTCTTAGAGGCTTGTCAGACTAGTATAGATGTTGGGAGTTAACTATTAAGTCGTATTTTGTTAT
CTTTCTGAAATTATTTTATTTTGGATGATGATTACTCTGTTGATATTTGAGGGTTATTTATGAAAACCCTATTGATTTGTGTTGAATTGATTGAAAATGG
CTCAAAGGGTTAGCTTAGGGCTACTCGTAGCCTTAAGCACCGTGTGATGCTCCAGGACCCATTTTTTGGGGCGTTATAGTTAAGTATTACTGATAAGGTC
ATTG

chr08 118,500,314 T C T
CCTGCTGCCTAAGGTTGACA
GGCTGTCACGGATGTCATCA
20
20
20
60.11
129
TTGGTTTAGAGAGAGAGAGAGAGAAAAGTCGTATATTGTCCATATGTCAATGATGATGGAAAAAATCCCTCTAAAAACCCTAAAAAAAGTTTTAAATAGT
TAACCCTAAATAAGGAAATAAAATTAAAGTTTTTGATTTTCTTTGGATTAGATGACGGTGCCTATGACACCCTATCATGATCTTGATGGCCTATCACGGA
CGTCATCAACTTCTCTGTAAATTCATCTCCTGCTGCCTAAGGTTGACAATGATGGTGATGCCCTATCATCATCTTAACGGTGTGCCATGATTGCTGTCA[
T/C]AAAAACTTCCTGCAGCTTTACATCTTTTGTTTAAGGTTGATGACATCCGTGACAGCCTATCACCAGGCTGACGGCGTGTCATGGATGTCGTCAGCC
ATACTTAGCTCTCTATTTGCTTCTAATTTCATGCTTTTTGCTTCCTTTATTTGTGGTTCCCCCTCTTCTCTACTTTTCCTGCCAAATCAAAGAAAACTAA
TCAAAAACGACTAAAGTTTCTCAAAACTTTGCAATTATTTAGAGTTAAAAGCTTCAAATGTGTTAGCATGGGCTCACACATCAACACCCTCAACTTAAAC
AATT

chr08 119,000,129 G A G
TGTGTTAGCATGCATTCCTT
CCCCCAGACTTGATAGCATGG
20
21
20
60.2
150
TGATAGCATGTAAGTTGAATTTTGATTCTCTTATATGGAAACCCTTGAATTATGATGTCATGATTGGTATTGTTGTTCATGCCCAAGTTTAAAGCTACGC
CTACCATGCATTTGAAAAAATGGTAAATTGAGATTATGGTGCTTTTATGATATTTTGGTGGTCTAAATGATGAACTCATGCTACACCCACATGTTCACAA
TGTCTTCCATGCTAAAGGTATACCTTGTATGTGTTTGATAAAATGCTCAAGAGTTTGGTTTAATGAAATTATGATGTGTTAGCATGCATTCCTTATTAT[
G/A]TGTAAGTTCATAACTTTCAAGTGATTAATGAAATGCCTCATAGATTGTATTGTTAGTTGTTGACTATTGTCAAGTATTTAAGAATTGTCATGTCTT
ATTACTTCCATGCTATCAAGTCTGGGGGTATCTAATACCCAACAATTTAGCTATGTTCCTAGAGCCCGTGTCAGTTACAAAATAGTCTCAGTTATGTCAT
GATCAGTAGTATTCTATTTCAGTTATAGAACTCAGGAAAACTCAATAAACTTAGTATCAATTCAGTCTCATTCACTATTTAGTTCAGTCCTTAGTAAACT
CATT

chr08 133,385,119 T C T
CCAAGGCACATTAGCATGGC
TGGATCTCACCCAAATCGCC
20
20
20
60.11
99
AGTCCGGCATTTCATTATTATTGTTACTATGAGTTTCGGTTTCAGTCCGGCATCTGATTATGCTTGTGGTTCCTCTGGGATGGGGTTTCTCTCGCTTTTG
GCATAGCGGGCCCCCAGTGGGAGGCTCGCACGACGGGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATAATTGCGTCGTTGTGCCTGGGCTGTGAGGGC
TCTCAGCCACATGGATAGTTCAATGTGCTCATCGGCGCCTGACCCTGAGATGTGGATCATCCAAGGCACATTAGCATGGCGTACTCCTCCTGTTCGAAC[
T/C]GGGGTTTGAAACCAAACTCCTCCTCAGGAGGATAGATGGGGCGATTTGGGTGAGATCCAATGTAGATCCAACTTTCGATTCACTCGTGGGATCCGG
GCGGTCCGGGGGGACCACCACGGTTTGAGTCTGACACCTGATTATAAGTTCTATATATGTGATCTATCGTTACTACCCACTATGTCCGGCACGTGTCTTC
TTGTTATTATCCATCACTACCGGTTTGAGTCCGGTGTCTGGCCTCTCTTTACTATCCATTAGTATCGGTTCAAGTCCGGTGCACATCTGGAGGACTATCA
TGAT

chr09 9,002,490 G A G
ACACGTTAAAGGCTTAGGCT
ACATAGTCGTTAACTAGCCAATCT
20
24
20
57.53
93
TTTTTTTTAATTTGAAGTGTTGTTCTTAACTTATTTATCCGCGGTTCTTCAACTGTAGACTCCTATAATCTTGGGGAATATATCTATAAAATAAAATTTT
TGTTTTACTCGTTTTATTTTTAAACCTGTTTTTCGAACTAATTTTGGAGTCATTTCAAAAATAGCTAATATGAGTATCATTAACTTCTTTTTGATGCATA
AATTATGTTTTTGGAAATTCTAGTTCCTGCTGAGACTATTGATAAAGTAAATGATACACGTTAAAGGCTTAGGCTTGTTTCTTTAGATTTTTTGTGTAG[
G/A]TTATGACTTAACTTTCTTCAGAATAGATTGGCTAGTTAACGACTATGTAACATGTGTTATAGGTTGAATAATTAAACATGGTAATTATATTTTGAA
ATTATTATTATTATTATTATGTGCTCGTGGGTAGATTATATGCATAGTTTTGTTGACTTGAGAGATTAAGTATTTTGTGTTGTTTGTGTTGGGGCTTTCT
TTGACATCCTAGTCCTTATTTGTGCATTAATTTCCATGTTTATTGTTATGAAGCCCTTGCGTGGGATTGAATAGATATTAATGGCCTTCTTTGAGCATTG
ACTA

chr09 24,000,008 A A C
GAGCGGTAGGCCCAGTTATC
TGTGTGCTTGATGATTTATGCCT
20
23
20
58.98
139
GAGAAGTTGAAGGGAAGAGATAGAAATAATAAGTGGGCTAGAACAGGGCAGTTTGAGTATGGTCAGACTAGGTTAGTAGGGGAAATCATTCCCAATTTCA
GAATTGTTCATCTATGCCAGCATAATCTTTAGCTAGTACTCCCACTCCCAGAGATAGACAGAAGCAGTAGGGTAAGTCGTCTATGTCCACATCCCAGAAT
AGTGTGAGCGGTAGGCCCAGTTATCCTCTATATGCTAAGTGTGGTAGGATTCATCCTAGTGAGTGCTTGGATTGGCAGAAGTGATAGCGTCAAGGAAGG[
A/C]TAAACACAAAAGGACACTTAAAGGCATAAATCATCAAGCACACAAAGAGAAAACAACACACTAGAAAGGGGATAAAGAAGAAGATTGCATAAAAAG
TAAAGATAGGTAGAAAGACCCTTACTTCTATAAAATGAATATCACAAGAAGGTGTCTCAAACATTCAAACAAACCTCACCAACAGAAGATCAAACCTTTC
TTTTAGGTGGACCAAAGGACTCACAGCTCCACAATCACACCTTTCTTGCCAAATAACCCAATATAAGTGAAAATAAATTTCAATTGCATTCAATGTTCAA
ATTT

chr09 33,023,302 G A G
TCTCATTTCCCATACTGTCCACT
ACAAAGCTACACAGACTGAACT
23
22
23
57.59
102
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAATGTCTTCCGATCGACATAGCTCTGCACACTGCTGAGTTAGCTG
ATTTGTAGCTATAGACTTCAGTTTACCTTCATTAGTCTTTAGCTTTTCTATCTCATTTCCCATACTGTCCACTTTCATAGAAAGCGTAGTTAGGGTGTT[
G/A]AGTATTTTTTCTAGAGTATCTTCCTCTACTAGTTCAGTCTGTGTAGCTTTGTTTTGATATGTAATCTGCAATAACATTTTTGTTAGTACTGATCAC
TTCAATTGTAAATGTGAAATTTAATATATTTAAAACTAGTCTTCGAATCTCTTTATAGGAACCATCTAGATGCCACTCATTTCTTTATTGATGAAGCTAT
CACTTATAATAAAAATACCTTTGATGATATTTTCCATAAAAACGTAGACTTTTAGATCTTCTAAATAGTATCCAGCAGTCCTCCTCCTACCCTACTAGTC
ATTT

chr09 54,000,033 A A G
ACACCATTAACACGTGACTAGT
CTGGTTTGGTTTTGGTCTTGGT
22
22
22
59.5
89
AGTTAAATTCACCAATCAAATCAATTTATATTCATCAAGACCCTTACAAAACCATTTATTCTTCATTAGCATTCTTAAACCAAGCTTAAGTTCAAAACAT
AATTCAAGTTTATTTTTAGGGACTCTAAACCCTTTAACCAAATCCAACCACCAAAGTCACCAATTAACTCCTTATATGGCCAACAAGGCCTTTATAAAAC
CATTTACCAAATATTCATTTTTATTAGACCAATTTCATAGTTCAAAACACCATTAACACGTGACTAGTTTATTTTCTTAGATATTTTCATAAACACCTT[
A/G]AGGGCATACCTTTACCAAGACCAAAACCAAACCAGAAATCATCAAGCTTAGGTTTATTCATGGCCCATTTATTTAACCATAATCAACAATCACCCA
CATGTGGAAACCCTCACTAAAAACATGTATAAACACAAGTTGAAACTAAAGTAAACAATACTCAACACTATGCATCAACATCCTCAATATTTGTTTTCAA
TATCGCCATTTACAAGTCATAATCATGGTTTAAAACACATGATATTTTGAACTAACAATGAGGGAAGAGTCACATACCTTATACAAGAAGATTCATAAAA
ATAA

chr09 64,001,120 G G A
CCAGTGATCCAATTTGCATCACT
GAGTCGGTTCACAAATAATTTCA
23
23
23
55.53
150
TTGGATAAAAAATGAATATCTTCTAAGAAATTTTAGAGCTATTCAACTTCTTCATCGGCCTTATCTAAAGCGATAAATTCATATTCCATTGCAGAGTAAG
CAATACATGTCTGTTTGAATGATTTTCAAGAGACTACTTCTCCACCAAAAGTAAATACATACCAGCTTGTGGATTTAATTCATTTGATCCAGTGATCCAA
TTTGCATCACTAAATCCTTCAATTATTGCTGAATATTTGTTATAATTTAAAAAATAGTTTTGAGTATATTTTAGATACCCCAAAAGACTTTTCATATTC[
G/A]TCCAATGAGTTTGATTGAAATTATTTGTGAACCGACTCAATTAATAATACCACATATTATATCTAGTCACGTACAATTCATGATATACATCAAACT
TTCTAACACTCTTTTATACTCCAATTGTGAGTCACTTTAATTTCACCTTCATTCTTTTGAAGTGAAAAGCTTACGTCTATTGATGTCTTAGAAATATTGA
AGTTCAAATACTTGAACTTGTCAAATATCTTACTAATATAATGAGATTGTGACAATATTGAAAGGACATAACTATCCAAAATGAAAAGATGTCTATTCTC
ATTG

chr09 97,500,009 A A G
TGGTGCTTGGCATACACTACA
CCGTTGCTGGGGAATATGGT
21
20
21
60.11
130
CGTACTGGTGTAGTTACTTGCTCTGCACGCCTTGGGTTACCAGGATTTAGAAACTCCTCGTCTCCCAAATCTTATCCTCAGGATTTTGAGGTTGTGCTTG
TTGACCGATATTTTGCACATTCACCTGAGCACTAGCTAAGGCTGCCAATCTATCAGCCTCTTACTGTTCTTCCATTCTTTCAATTCGTTGTGGTTCTGTA
TTAAGTGGTAATAATGGTTCTCCAGAACTTATGGTGCTTGGCATACACTACAAGGATCCTATAATAAACAAAAAAAACATATAAACATAAAACTAGAAA[
A/G]CTTGACTAATAGTCAATTAGCGCACCCAACTTCAATTTACAACCATATTCCCCAGCAACGGCTCCATTTTTGATAATGCTCAAACCAAACCTCTCT
ATTGAGAATGTAAGCGATCGTTGTCAATATAAAACCCAACTAGGTTGGGGTCAAATCCCACAGGGAATATGGTGTGAACTTAAGTCGTTTGCAATATAAT
CAACTGATAGCTGTATGTTTCCAGAAATGAGGGTTTTTAGTTTAGCAAGTAATTGTTGGTCACTTTAGGTATAGTGTTCGTAATCAAGAGTTTATGAAAA
AACC

chr09 118,004,385 C A C
TGTTTGTTTGAAGACTTTAATGCA
GGATGTTACATGATCGGACCGA
24
22
24
59.96
149
TATTTGGTTATGTAATTAATACTTACTAGACTTATTTTAGTATAACTTAATATTTTTAAATTATGATATTTTTATTAGTATAACTTATTAGTATGCAATA
TTTATGTTATACAATTTTATTATTATTTTTTGTTGACTACTTATAGTCATAACTCATTTCATATTTCATGTAATTTTCTTAAGAAACACTTAAAAGATAG
TTACATCTTGTTAGGACTAAAGAAATATTTGAAACACAAGTTAATTATATGTTTGTTTGAAGACTTTAATGCAAAAAAATTGAAAAAATCTGAGAAATC[
C/A]AAAAAATCCAAGGTTGAAAAACCTAAAAATTAAAAACCCAACTCAAATAATTTAATTTGATATTTAAAAAACCGAATCGGTCCGATCATGTAACAT
CCTACTTTTTACTTTTTAAAGTTTCTTCGTGATCCAACAGTTACTAGTATGTATATGCTATTTTTACTCGTGGCCAAAAAAGAATGGTGAATTATTTACT
ACGACCTCTGAGCTCTTGCAATTTTCAGGAAATTCCCCTTTTGTTTCAAAAGTTTTTCTATTTCCATATGAAGCAAGATGTGTAACAATTATATTGGAAA
CGGG

chr09 125,500,317 A A G
CCCTAAAGGTATTGATGGCTACT
AAGTCAGCCAGGAGAAGCTC
23
20
23
59.39
141
AGGGGATTCACCTTCATGGAGTCCCAACATCCATTGACCAACAAATATACTCCAACTAATTCAAGCTTAAGAAAATTAATATGGCAATAGCTTTACCTTA
CTTGGTGGAGATCTTTATTTCCTTAACTTGAGCTTCTCCAAGATCTTGGACTCTACTTTAACTAAACTTATATAGAAGGATAGAATTAATAACCCTAAAG
GTATTGATGGCTACTTAATGAAGCTAAGAGAGAATAAGAGAGAAAATTCTAGAAACTAGATTTTTGTTCAAGTTAAAATAGGTAAAATGAACTGGTTTC[
A/G]CTCCCTTTAAAGGGAGCTTCTCCTGGCTGACTTTATTGGACATTTTTGGGCCATAATGTGATAATTAGGTGGACCTACTTGGCCATTTGTGGATCT
AAAATTATTGGGCCTTGACTTCCCATTCTTCTCCTTTTCTCTCTTTTAATTTAGGCCAATTCAAATAGGTAGTAGTATACATGGCCCAATAAGCTGGTCA
AAGGAGTCTTAGTAGGTGATTCACCTACTTAGTTCATAGTTTGGTCAATAAGTCAAAGTAGGTGATGTACCTACTTGTCACCTACTAGCTAAATTTAACT
CAAG

chr09 139,000,050 A A G
GAAGGGTGGTGTGTAGCCAT
GGTGTCTGTCCATTTCACACC
20
21
20
59.12
120
GTTATGGCTGGATTGTTCCCTCAGTATGATTAGACTGACATCCCTGCTACAGCTGAGACTACTGAGGCAGAGTCACAGATAGAGGTCATACCTACAAGTG
CAGTGGGTATTTCTAATGCCCCACCACCTATCCAGTCCATGATGCCACAACCTCCAGGTATGCCACCCTATGTTATGCTTATTTCACAGCCCTTATAGAA
AAATGTTATGACGAGCGTAGACATATAGGAGGCTAAAGTGGTTCAAATGAAGGGTGGTGTGTAGCCATAGATTGACTATCAGCTTGAGTAGTAGGATAG[
A/G]AGAGTCTAGACTAGACTAGATACTTTTGAATCGAGGATGACTCGATAGGTGTGAAATGGACAGACACCTAATGTTACAGAGCTAAAGATAAAGATG
ACATATATTAAGAAGATGGTGCATAAGCTATACAATAGACCAGTGATTCCAGAACTATTCATTGAGATAGTGATGCCCATTGTCCAAGTACTGAATATTT
GGGCCATAGTAGAGTTGAGGATTGAGAAGATAGAGGAAGAAAAAAGATCATGCAGCTGAGAAGAGGGCCCATGCTGAGAGTATTCAGGATGAGTGGGACT
GTGA

chr09 157,500,039 C C T
GGTATGGTTTGGCATGGTTGG
GCCAGCCTTGAGTTTCCTGA
21
20
21
60.25
146
CAATATTGGTTTAGGCTATAGTTAGGGGCATGTCCCAACTGAATTTCACTATTCTTTTGGTTAGAGGCTTTGTGGTACTTCTATGGGTTAGAATGGGTGG
GATTGATATAGGTGTCAGCTTTGGCATTGGAATAAGCTAGGAGGCTAGCATCATCGGACATAATTTCTCACTGTTCTGTCATATTACATTTTGGGATTAA
TTATATAATGTTTTGGAACATCTTTTGTTATATCCTAGTTTGTGGCCTTATTTGGTATGGTTTGGCATGGTTGGATTATGTCTAAGTGATAGTTGGACT[
C/T]GATTGGGTCAGTCACGGTTGTGATCTATTCTGAGAGTCCTTATATGATCTTTTACTCTACTTTGTTACATTATCTAAATTCAGGAAACTCAAGGCT
GGCGCTTGGAGGATGGGTTGGGTAATGGGGGTTGTCTCTGGTTCTGGTTAGATTTGGGACGCCCATTATGACAAGGTCCTAGGGTGGGTCATTGTAAGTT
GGTATCAGAGCTTAGGTGCGTGGTCAATTTGGAGTCCACGAAGCCATATCAAGTAGAGTCTCCCTTAGGGGTGTGTAGCACGCCACACTCATAACAAAGA
AGAT

chr09 170,500,052 C C A
ACCATCAAGTGAAACATGCAAGG
TCGTGATGAGCAGCTACATCT
23
21
23
58.97
122
AGGGGTTTTGAAGATGTCACATTTTCAGTCAAAAAAACCACTATTTCCAGTATTTCCATGGTGGTAGCAATGTTTCTTGAATAAATATGATATAAGAATG
TAATTCTCATAATCAACCAAAATAAGAATATCCTAAATCCAACCAATATACCAACCACGTGAGTCTAAATTCCACTCAAATCAATCAACCATCCATGATC
ATATATAATTAAGAAACCATCAAGTGAAACATGCAAGGAAATAAAATACCCCAGGTTTTGGACTCTAAAATTTCTGAAGTGAAATTAACACTGCCCAAG[
C/A]AATGACTCAGATGATGAGATGTAGCTGCTCATCACGATTTGTATGGTGCCATTCATTGCCTAACTAATAAGGTTGTCTTTGGTCACTATCATGATC
ACGACTAGACCCCACGATTTATAAGGTAAGGTCAGGAGTCATGGCGAGGTACTTGTGACCATGGTTCCATGCAACGACTCATGACCAATCACCATGAGTT
GTTACCTGACCCATAACAACTGGGAGATACTTTCCTACATGTGTTTCTTTAAGGGAATTTTGGTCTTTTTCCTTCCTTTACACTTTAACCACTACCTTAA
AACA

chr09 194,500,158 C T C
TCAAGCTACCCCACTTTTCT
AGTCAAGCAACACCAAAGCT
20
20
20
58.23
112
CAGAATACAAAGTCTAGAGAGTAGGAAATTTGTCCAAAAAGTAGGGCCCACCTACGATGGACAGCTACAGACCATAGGCACCATCTACGACCCGTAGGTG
GATAATCTTGGGCTTAATTTTTGTTTAAAATTTTAGGCCCACCTTTCTTTATAATAACCCTAAGCTAACCCCCCATTCCTATTTAAACCCTTATAATCCA
TTTTTAACTTATAAATCCTCAAAATTCCCTTTTCTCTCTAAAAATTCAAGCTACCCCACTTTTCTATACTTAAGAAAAGGCTAAAATAGGACTTGTTCT[
C/T]GGTTCCAACTTGTTCTAAAGCATTAGGTACTCATTCAAGCTTTGGTGTTGCTTGACTTTTTCATGGTTAATTTTTGTTCTTTGAAAAAAAATGTAA
TATTCTAGTCTCCTAATAGTAGTATCTTGTGCTAAACATGAAATAAGTAAGTTGGTATGACTATTTTCATGAAAAAAATGTAGAAGCCATCATGTTTGTA
TATAGGAGCCTTGAATTAGCCTAAAATCTTAATGTGGGGCATTGTTCCCTAATTAACCTTAACATCATTCCCTAAACGAAAGTTGAATTTGAAAAGGTAG
AGGA

chr09 219,500,067 A A G
ACAATGGGTGTACTGAGGCT
TGGCAAGAAAGGGAAACTCA
20
20
20
57.25
119
GAAGAGATGAGGGTACTTGGTCTGTATATCTACCTCTGCTTCCCAAGTGGCTCCCTCAACGGACTGATTCCGCCAAAGAACTTTGACTAGTGGAACTTCT
TTGTTCCCTAGTCTACGAACTTGATGACCAAGAATTTCGACTGGGACTTCCTCAAAGGAAAAACTGTTCTGAATATCTACACTTTCTAAGGAACAACTAT
AACTGGATCACCACTACATTTTTTCAACATTGAGACATGGAACAATGGGTGTACTGAGGCTAAATCTGAAGGTAACTCAAGCTCGTAAGCTACCTTTCT[
A/G]AAAAGAATGAGAATTCTGAAGGGATCGACATATCAGGGATTGAGTTTCCCTTTCTTGCCAAATCTCTTCATTCCCTTCATCGGAGAGATTTTCAAG
TACACAAAATCACTAACCTCAAACTCGAGATTCTTTCTTCTCACATCAGCATATGATTTCTATCAGCTCTGGGCAGCCCTAAGCCTTTCTCTAATCAACT
GAACCTTCTCTAACGTATCAAACACCAAGTCATGCCCTACTATTGTAGCCTCTCCTACTTTAAACCAACCAATTGGAGATCTACATCTCTTAACATAGAG
CACC

chr09 241,005,767 C C G
AGACTGAAAAGGGCTCTGCA
CTTTGCTAGACCCAGGTGCA
20
20
20
59.96
99
CTACCCTTCCACTCTAGGACGGGCTCATTCGGGAACTGAAACTGAACTATCCTGTTTCTGCAATCGACTATGGCATAGCAGGAATGAAGCTAATCCATGA
CGAGAATGACATCAAAATTAGTCATCTCTAACTCGACTAGATCTGCTAACGTGGATTTCTGAAATATCATAACCGGGCAATTCCTGTATACCCACCAAGC
TATAATGATTTTACCCACTGGGGTAGAGACTGAAAAGGGCTCTGCAAAAATTTTAGGACTGATTCTGAAATCGTTTGCTATGTATGGAGTGACAAAAGA[
C/G]AAGGATGCACCTGGGTCTAGCAAAGCATAAACATGAACATGGAAAATCTGTAGCGTACCAGTAACAACATCAGGAGAATTTTCCTGATCCTGTCGG
GTCTGAAGAGCATAGAGTCTATTTAGGCGTTGCCCACTAGTAGCACTGGAAGTGGCACCCTGCTGGTTCGGGCGACCGGACTGAGCTGTGGAACGATTCT
GTTGACCCTGAGAACCTGGCTGAGGATAGTACCTAACTCTGTGGCCTGGCTTTCCACAACCAAAACAAATGCCTTGACCCACTCTACACACACCCTGATG
GTGC

chr09 245,000,036 A G A
TCAAGCACGAGTCCTAAAGGA
CCTTGGCAGGATCATGCTCA
21
20
21
60.11
105
TATGCTTCTTTACTTTCTTTTTCAACTGCATAATCACAAAACATGAATCAGCGCAGACTACTTGTTCTCTCGTTGCAACATTCAGACAACAAAAAAAAAC
ATACTGTTACATCACTAATTCAAAAATATCCTACTCTATTATTAAGTAAATATATTGCACAGTATGTAAGAGCAACATCCTCATTCATGACACCCTAAAT
GCTCAATAACTATAATAATTCATGAGGCATGATACCAAAGAGGTTGATTTTTCAAGCACGAGTCCTAAAGGACAAATTCATGATCATTAGCCTAAAACG[
A/G]CAAATATATGTACGTGAGCCTAAAATGGCTGAACCATGAGCATGATCCTGCCAAGGCTAACATTTTGATCAAGAGCTAATCAAATAAATAAGATAA
TGTCATGAGCATAAGGGAGTTAGTTAGCTGACCGTGAAGGCATAAGTTGAAATGACAAATGCTCGAAACTATGTTTGCCGACATAGGATAGAGATTATTT
TGGAAGTCAGATGACTCTTTTTTTTATGTGTCCCGAAAAGGGACTAACCATGGATACTTGCTAGCAAATTATGTCATGTCACGTCCTATGCCCGGCAAGG
TATA

chr10 6,003,541 G G A
TCCTAACCGCCACTGTAGGA
GGTTATCACTAAAGCTGTCAAGGA
20
24
20
58.51
98
GATGTATATCTGTCATATTCTTGAAGTCTTGGGGGAAAAAGGTATTCATGGTGAATTCTTTTGTAAGTTGCTTGGAATTTATGGTGTTTCAAAGAGCAGC
CTTCTGTTTGGCGATGAGTTTCATGTATATGTCCACCTTCTTCAATAGCCCCTGAACTTCAACAACTTTTGGAGAGGGAGGAGTTAAAAAATTTTTGGTT
TCAAATTGGAGAGTATATTCCTAATTGTTCTTTTCTTCTTCCTAACCGCCACTGTAGGAGTGTATGGCTCCCTCATCTTCTTAGATGGTATGACACCCC[
G/A]CTTGAATTTTAATTCCTTGACAGCTTTAGTGATAACCTCTACTTTTTTAAAGATTTTATCCTATTTGTTTATGCACTCTTTGTATTTGCAATGAGA
ACATAAGGGTAAAGAGGGGTGAGCGGGATCGCTGCAAGGGTGAAAGGGATCGGTGTAAGGGTGAGAGGGACCTGTGTAAGGGGTGTTTTCAAATATATTT
ATTTTTTCTTGAGCATCAACATGCTCATCATCATGACTGGTAGTAATATCAGCATCAGCATGGCTGCCACCAACATCAATAACTCCACCGGCAACACCTT
CAAA

chr10 6,513,439 G A G
CAGTTTTGGTGTGCCCTTGG
CACTGGCAGACCTAGGAAGC
20
20
20
60.11
149
GATCAGGATCACAGGGAAGAAAGTTCTGAACACAATGATGAGGTAGTAAGGCTCAGGCAACAATTGATAGATTTACACCGGGCATGGGCCAGCGGAATGC
CTCCTCCTCCGCTTCCTGAAGGTCTTGGGAATATCTCTAATTATCCACCGCTTTCTCAGGCGAAATTCTCTGCTCCTACTGAGTCACCTGAGCACGCGCC
AGGATTCACTCCGCGACATTATTATCCTGGCAGTTTTGGTGTGCCCTTGGCAGTTCCCCAATCAAGACCCGCTGCTCAGCCAGTGCCACCGATCACACC[
G/A]ATATTCGTGGATCTGCCACCACATGAAACTCCCATATATGCTGTGCGTCCCACAATGAGGCTTCCTAGGTCTGCCAGTGAGCCAGTACTGAAGGTT
TCAGATAGTCAGTATTATGCCCCGGAGCCTACTTTGCAAATGAATGAACCGTATGGGTACACTCAGCCGCCTGCATTTCCATTTGATACGGAGAAACCTG
TCACAACGGAGGAACAGGATATCATAGCCCGGAAATTGAAAAGTTTAGAACAGGCTACGAGGAATTTGCAAAGAATCGGAGACTATAGAAGTGTTTCCTA
TAAA

chr10 10,500,085 G G A
TCCTCATGCTTCAGTCAAGTGT
ACTGCTCACAACTACACAGT
22
20
22
56.72
115
TTCATAGAATTATGTATGATTCCAGTTCCCAGTATAAGGAGTTCAGTTCTATTCCCCTTAGTAATTCAAATCATGTCATACGAATACAGAAAACTCCAAA
CTCAGGTCATGCAGCTTATGACTCATGTACACATATCATGCTCTACAGTATACTCATCTTCTGTGACTCCTTCTACACCCCTACTGATCAGTTAAATTCA
GACTATGTTATACATATCCTCAGTTTAGACCACTTAGTGAATCCATGATATTTATATTCTATTCCTCATGCTTCAGTCAAGTGTCAAAGTTCAGTTAGT[
G/A]TCCATTTATGCTTCAGGTCCTCCTGATTCAACTCTTTAGTGAGCTCTCTTTGTGAATACTGTGTAGTTGTGAGCAGTTACATAGATAGGAGAGAGT
ATATATTACATATTAAGATAAGATTATTGCATGCTTATTGTACACGAGGGTGTAGTTATAAAGATAGGGTTGAATGTCATGTTAGTGTGCAAGTAAATGG
ATAACAAGAGTTAGTATTTAGAAGTTGGGAAAGTATAGAGTGTAAGTGTACATTCAGATCCTTGACTTATGTCAGTCTTCATTACGTAACTATCAAAACT
CAGT

chr10 62,500,030 G C G
GCCTTGATGCTACCAGTGGT
TGGAGGCTTAACATTCATCACCA
20
23
20
59.99
149
TAGTGACATTTTTGCCTTCGTTGTGTGGAAGTACAAATGCCTTCACCTAATTTGATACATATTCAACTGCTATTAGAATATACCTCATGCCATTGGAGTT
CACAAATGGATCCATGAAATCAATCCCCTACACATCAAACAACTCAAACTCCAAGATAGGTATCATAGGTAGTTCATGGAATCGCAAAATATTGCCTTGA
TGCTACCAGTGGTCACAGGATTATGAAAAATCATAAGTATCCTTGTAGATTATAGGCCAATAAAACCCACATTGCAGAATCTTATGGGCTCTCTGTGTA[
G/C]CACTATGATGACTCCTAATTGGTGATGAATGTTAAGCCTCCAGAATGCTTATCATCTCCACTTTTGGTATACATCTCCAAATTATTCCATCGGCAT
AAACCCTAAATATATATGGCTTATCCCAAAAGAATTTCCTTACTCATGCATAAATCTGCATCGCTACTGGAAGGATAAATCTTTTGGAACGAGATCACTT
GCCAAGTAATTAGAAAAATCAGCAAACCATGGAATCAGATCATAAGATGCTACTAGCGCACACTCATTTGGAAAGTATTCATCTATCTTAAAATCATTCC
CTAG

chr10 83,500,086 G A G
GCTGATGGAACTTTCAAAATTGGA
TGACTTGCTAGAGCTGCCAG
24
20
24
59.75
150
AAATTCCATGAACATAAATAAATAGTGCTACCCTATCAAATTCAATATTTCAAACTTAATGGCGCCATCAGAATTTCCATCCAAGATTATTTTGATGAAA
AGTAGGCCCTACACCCAAAGGCCACATTTATCAAAATCCACCCAATAGCCTGAAATGTGTCTTGAGGCCTGGGACCCAAAACAAAAGTCCCCTAGCCTAA
TATAGACCTTTTAGAGCTGATGGAACTTTCAAAATTGGATAAAAGATCATTAACCTGATGTTTATTCCTGATAGTTAATCCTTAACAGAGAAACTTAAC[
G/A]CTGGGGATTTGGTCTTCAAACCAAATGAACTACCTGATAACCTAACTGGCAGCTCTAGCAAGTCATAAATGACTTGAGGCATCTATAGAAAAGCTG
TAAATGGTGGATGAGTGTGGAAATGCATAAAATGACCTGGCGGGTCATTACACTAGTTCTTGAAGCCTCATTCTTTGCTAACATGGGGCACATAATACTA
TCCCCAAAAAGGAATTATTCATCTTTACGATTGTGAGGGGTGGGATACAATTGCAAAGGTGTCAATTTTGGTTGAGTGTCTAGCCCTTTATTACAAATGC
AATA

chr10 87,000,037 C G C
GGCTTTACCCTTTGAGAGAGA
TCATGGCCCAAGTCAGTCTT
21
20
21
58.93
112
TCATGGAAAATTGAAACCTAATTACTATCCTTAACATGAATACAATCAGTTTCAAGCATGGAATTCATAAATCTGAGATCTTGTAAGTTTAAAAGGGGCT
CTTAAACTTCATGGGTGAAAGAAACCCATGAATGAACACCTAACATATCTGGGAATATTAATTCTTGAAGGTTCTTGGAGGAATTCCTGAGTTTGTTCTT
GATTTCTTAAAGTTAGGGCTTTACCCTTTGAGAGAGAATGTTTTAATCTTGAGAGAAAGTGAGGAAATAATGCTATAACTAGGTTAATTAGGGGTTAAT[
C/G]ACGTGTCTAAGACTGACTTGGGCCATGAAAAAATACTCAATGACCCCTGGGAAATATTTAAAAATTCATCATTAGATGCCCGATTTTTCACCGCGA
TATGGTGGCATCGCTGTGAGCCACTGGAATGTGGTTGACACTGTGTAAAATGGACGAATGCAAAATTGACCCTTGGTTTGACACGGCACCATTGCGGAGT
CTCACTGGATTTTGACAATTGGAAAAATGGCCCTTGGTGGACGCAGTGGGATCACGGTCCCTTACTAAAAAAATAACCATTATGAACTGGAACATTGGTG
TAAC

chr10 91,000,171 A G A
AGGGGTTTTAAGTCGTGGGT
ATTAACCGTAGCGACTGGGC
20
20
20
60.18
99
AAGAAACAATCCTTCCAAAGCCCTTAACTCATATCAAGACCCATGTTTAAATCCACATAAACAATCATATAATTTCATGATTTAAGCAAACAAATTAAGA
GGTAGAGTCACATGCCTAACATATCAAAATTTATGGAGAGAAAACACTCGTGAGAGCCCTAATTGATCAACTCCTTGAAAACCCCAAGTATCTTGACCTT
GGAGAATTAAGAGTGTTCTAAAAGTTATTTCAATTTATTTTTGAGTTATAATAAAACCCTAAAGGGGTTTTAAGTCGTGGGTTATGTTTTGGGAAAGAA[
A/G]GAAATGTCCATTATGCCCTTATTAAAAAGATTGAAACTACCGCCCAGTCGCTACGGTTAATGTTATGACTCGTAAGTTCACTCTGCATTAGTGACC
CTTAGTTGTATGTTGGACAGTGTCCAAGGGCAGCCACACTAGTCTGGTTACAATTCGGTAATAAGACTCATCAAGGGACCTTATGAATCGTAAGGTCCTA
GTCATAGTATTAGTAGAAACTTTGGCAACAAGCACTGGTTTTGCTATGGATGGGACAATATGGCTAGTATGGAGTCTTTACGACTCACTAGGAGCTAGTT
GTAA

chr10 117,000,213 T C T
GCCCCCTTCTCCTAACATCC
AAGCGGGTGAAACTGCCTTA
20
20
20
59.89
132
TCAGTAGGAGTAATATGAGATGGATCTCCAATACACTTTCGAAGCATTGAGACGTGAAATACCGGATGAACTGTTGAGAGCTCTTGGGGTAGCTCCAATT
CATAAGCAACTTGGCCAAACCTCCGAGCAATCTGGTATGGGCCTATATAACGTGGACTTAATTTTCCTTTCTTACCAAATCTCATAACCCCCTTCATTGG
TGATACCTTCAAGAATACCCAATCACCTATAGCAAACTCTAGCCCCCTTCTCCTAACATCCGTATATGACTTGTGTCTACTTTGGGCTATTTTTAGTCG[
T/C]TGTTGGATCACTTTAACCTTTTCCATAGCTTGATGAACAAGATCTGGACCGAATAAGGCAGTTTCACCCGCTTCAAACCATCCAATTGGTGATCTA
CACTTTCTTCTATACGAAGCTTCATATGGTGCCATTTTGATACTTGAATGATAGCTATTGTTGTAGGCAAACTCGATGAGAGGTAGATTATCATCCAAAT
ACCTTTAAAGTCCAATACACAAGCTCGTAGCATATCTTCAAGTGTTTGAATGGTACGTTCTGCTTGTCCATCCATTTGAGGGTGTAAAGCTGTACTTAGA
TTAA

chr10 121,000,018 T G T
TCACTTGGCCTAGTTTACACT
ACCCTAACTCGTACCCTAGACC
21
22
21
60.09
149
AAAATTCCCTTAATTCAATCTTCTGGACTAGGTATGACTCAGGGTACTAGTCATACCCTTGTACATGACTTAGTGACCTTCTCTCATATCTTAGGCAGTG
TAGTGGGGTTTATACACTGTTTAAGGTGTGACTTAGCCTCTCCATCTTCGTATGTTAGTGTATGATTCATACCAAGCTAAGTCATATGGTGTTTTTCACT
TGGCCTAGTTTACACTATTTTGGGTATCGTTTATGGGTATGATTTAGGGTACCATTCATACCCTTAGGTTATGAATTAAGAGTGTGTAGTTGTACCTTG[
T/G]TCTATGTAGGGGTCCTTGATAAGGTCTAGGGTACGAGTTAGGGTACCACTCGTACCCTAGGGTACGGTTGAGCTAAGTGAGTCGTACTCACCGGGA
AAGTCACTTTTTAGTTTTTAAGTCAAGGGATCTAAGGACATTCCACAACCCAAAACCCTCGGTATATAATATTTTTTGTCCCTTAATTCTTCATAATTAC
AAGACAAATACATAAAAATCCTTCCAAAGACTTCTCCCTCAAGATTAAAGCTAGGGTCCTAAGGGTGGTCATCTAGAGAAAAGAGGAGTCAAGTTTTGTT
TGTG

chr10 153,500,008 A G A
TGATAACCACGTGCTTCAAGA
TACCCCCAGGACTCGATAGC
21
20
21
60.18
117
TGAGTTGAAATACGGAGTTTTGTATTATTAATTTGATGGTCATGCCTATGCCCTAAGTCATGCATCCTAGGTGTTTGATAAAATGCCTAAGAGAATAGAA
ATTATGAAATATAGCTTAATTATGACCCAAGTGATAAATACATGCTTTACCCTATGACCAAGAATGACTTTCATGATATTGTGTGTATTATGAATGGTTA
AGGGAATGTCCATGAGAATAGGTTGATAAAAGTATGACATGTTTATATGCAATTCCATTCATGTACAAGACTATGATAACCACGTGCTTCAAGAAATCC[
A/G]CAAATTGATGTATTATGAATTATTGATATTGGTCATGTGTTCAAGAAGTGTCATGTTCTGTCAGTTTCATGCTATCGAGTCCTGGGGGTACTTGTA
CCCGATAAGTTAGTTGTGTGCCTAGAGCTAGTGTCATGTTTTCACGATATCCTCAGTTAAGCCATGTTCAGTAGAATTCGGTCAGTCATGTGACTCAGGA
AAACTCAGTAAACTCAGTAATCCCAGAAATCTCAGAAAACTCAGTATTTCAGTAATCTCAGTAGTATTCCGTCAGTCAACGAAACTCAATGAACTCATTA
ATAG

chr10 163,000,030 C T C
ATGGTTTTGACCACCGTGTT
GGCCCATAGTGCATCGTCTA
20
20
20
59.32
108
TTGTTATTTTTCTTATGTATTGATTAGTGTTTGTAGGACGCATGACACAACTACCTATAGTCAGCACAGTAGAGGCTTCATATATGGTTAGTTAGAGTCA
ACACGTGTGATTCAAGTTTCTTTCCTCATTTTTATCATGTTGTAGAATTTATCAGAATTTCACTTATTCAGAAATTCTCATGATTATGCTTCTGCTCATT
AAATATAGTTTTTAGATAATTTAAATTAGTTGCTTAATAAGTATGCCAGTTCATAGGTTAGCTTGGGATTATTTATGGTTTTGACCACCGTGTTACGAC[
C/T]AGGGGGTAGTCTCATGCCATGACAGACTATGAATTCCAATAGGACTCATTGGTCGATAACCTTAGACGATGCACTATGGGCCTATCAAACAGTTTA
CAAGATCCTTATTAGTGTATATCCTTATCAACTTATTTATGGAAAGGCATGCCACTTGTTGATTGAACTTGAGCACATGGCACTATGGGCGTTGAAGAAT
TTGAATTTTGAGTGGAATTATGTTGCACACTTGAGTTGGACAAGATGAATAAGATGGATGATTTTCGCCTCAGTTCGAAAGAGAGTTCAACTATATACTA
GAAG

chr10 166,500,373 A G A
ACTCTTTTGTTGTGAGGGGCA
TCCAAAACATCCTAGCCTCAAGA
21
23
21
59.41
124
TTTTACCCATCCCTTAGCCTACATTACAACCCGAAAAAGACCTACTTGATCCTAAGTTCATCATTCTAATATTAGTGAAGGATTACGCTAAGGGCAAGAT
TATGGTTCATTGTGTGTAACTTGTGAATTCTTTGTGAGAGTGAGCGTAAATTGATTCTTGCACCCATATGTTATAAATTGCATTAATCTGAGTGATTATA
GGTAACTCTTTTGTTGTGAGGGGCACATGTTTGATGAATGTAGGTTATTGGTATGATGACCTTGATTGAGAAATATGCATGAGTTTTCCAACTAGGTGA[
A/G]TCAATTCTTGAGGCTAGGATGTTTTGGATTAGAATTCTTAAACTTTCAATGGTGTAAATAACATGCTTTGTGTAGAAACTTGAATTCTGTGTATTT
ATTGTAGTACTAGCTTGAGTGTATTTGTTTTAGTAGAAGTGTAGCGTCACCTCATATTTTTATGCTTAGAGTAAAGAGTTGTTCAAGGACGAACAAGGAT
TTATGTTTGAGGTGATGATCTGAGGTGGTTTTATACACTTTGGTATCATTATTCTAGATTATCTTTCCTTGTTTTGAGAGTAATTCACGTGCTTAACATG
TTGA

chr10 184,500,147 A G A
TCTAACAATTGGACTATGACACT
TGTGAACATCTTTTGATTCTTGAA
23
24
23
55.48
145
GAAAATGTTGACTGATAGTTATAATTTTTATTATAATAATATAGAAACAAATTAAAAAGAAAAAAAATATTATGCTTGATCAAAAAGATGTTTCAAGCCA
CATTAATAAGAGAAAATAATAAATATGATCCTTAATAATGAATATTCATCATATTTTAAGAATCATAACCTACAAGAAACACATACAAAAGAAACAAAAT
AAATAACTTCAAGAGTTCTAACAATTGGACTATGACACTAAATTAAATTAAATCCAAGATGTTGAAAAAAAAAAGAAGAAAAACAACTTCTTGAGAGTG[
A/G]AATCTATAACTTTCAATGTGTTGATTTGGAATATGATTTCAAGAATCAAAAGATGTTCACAATATTTTGGCCATTGCGAAAAGCCCTCAAGCTACA
GTATGATGAATGAAACTTGCAATTTTTTCTTGATGCCGAAAACGACTATATGAGCATATGTATGAAGAAGTGCAAGTGTTTTCACCATTAATCTCAACAC
GAAAATTTTATTTCGTAAGATTTGGAGAAAATAAAAATGAGCATCCATCAAATCCATATTAGATTGTTATTTATAGAATGGTTAGACTATAAAAATTAAA
TAGA

chr10 212,500,417 A A C
TGAGGTAGGCTAATATGCATGGT
TGATCTTTATTTAGTGCTTCATGC
23
24
23
55.83
88
AACTAACTCTAATATCTGATAAGCCTCTAAAATTGAATGACTATGCATTGATGAAATAGGCCCAACTAACTCTAATTAACTACTAAAATGAAACATGAAA
TAAGGTAAGCCTATCCTTAAAGTATGAGGACTCACCACTACTACTGCTGAGGATTAAATAAGTTTAATCATGAGCCGGGAACTGAGCATTAGAACCTAAG
ATATAATACATCATAGCACAGAAGAAAAGGTATATGATCAGTACTTTGAATGTACTTGTATGCTAAATGAGGTAGGCTAATATGCATGGTTTCATGAAC[
A/C]GAACTAATAATTAACTGAATATGCATGTAAAGCATGAAGCACTAAATAAAGATCATAAAATTTATAGGTACTAGGAATATGTGGAATTCTATAAAT
ACTGAGTATGTACTAAAATCTATAAATTCTGAAGATACATGAAAATCTGTAGATACTGAGGATGCATGACCAAGCATATGACATAAACTATGTAAAATTT
GTAAATTGAAATACTGAATAACTAAAATCTGTATGAATTGGTCAAACAACACTAAGACTGAGTAACTGAACTAGGACTATAACTGAGACCGTATCTTAGA
CTGT

chr10 217,000,199 C T C
TGGAGTTGGTGTGATGTGGA
CCTTCTCGGGTTCGGTGATC
20
20
20
60.18
150
GGGGTACATTTGACATGAAATGGATTCTGCGACATGTTGTGATGCATCAACAACATCAAGAAACTGACTTTGCAATTTTGGTGGAAGACTCAAGGTATTT
GCAAGGTCAAAAGTGGGGAACGGAGGGGGAGGCAGCCCACTAGCCCAGGCTCGATACATTTCCATTACTTATTGTCTTAGTCTCCAATTCTCTTCCTTTA
AACTCTCAATTTCTTGACTCTTTGATTGATCCATGATGTCACTCGCTATATCCTTGTTGGACACAACTAACCTTTTGGAGTTGGTGTGATGTGGAGGAC[
C/T]AGCCAGAATTCCACAAACCAACCATCATAAACAAACTGAACAAGAGATAGCAAATGCGTTAGAGTTCAACACTTTTTCAAAACTCTTTTTTCCTTT
TTTTTATAAGATCACCGAACCCGAGAAGGGCGCCTGCATATCTCACCCCGAAAGAGGAGAATCAGGTGTGCGTAGTTCGTGAAGTCTTGCCAAAATGGCC
AATTAAACTCTTTTTTCTATTCCTTGAAACTTTAAGAAGAAAAGAAAATAACAATTTGTCAAAAGAATTGACGAAAATCTTTTTGAATTTTTTTCAATTT
TAAC

chr11 8,500,005 G A G
AAGTTCGAACTTTAGCGGCT
ACACACACAAAGAGCACATACA
20
22
20
58.46
150
ATTATTTGTTGCGCTTTAATAAAAATAGTAATTAGTTAAGTCAAGAATTTGTTATTTGCTTACTAATTATTTTAATGGATTTCAAAACCCTCATATAAGA
TATGAAGTGCTAGCTTTATTTTTCATCCAAGATGTTTATTCCTTTTTGTTCGCATGTTGTCTTTTCAAAATGATAAGAAAGTTCGAACTTTAGCGGCTAA
ATAAAATTATTTGGATATTTTTGACTCATGCATAGTATGATTGTGAAACGATATTTCACTTTTAGAAATGCTAAACTTTTATGCTTACTTTCTTACTCC[
G/A]GATTGTTGTATGTGCTCTTTGTGTGTGTAAAGACTTGATTCATGTCTCTCTTTTATTTATAATGTCAAAAGAGAATCAATGATGTCTTAGAAATAT
AAACCATAGGTCGTTACGCGTTTTTCCATAAAATGTTGATTGTGATTTAGATGTATGAATTTTTGTTAATGTCGCCTTAATTGAGATTTAGGATTCTCTT
GCTTGAAAACTTAAGCTTTATTTTCTTTTGTTATATGGATTAGTATCTATGTTTGTTCAATTTTAGAAGTCGTGAGTATTTTCCTTATTGCCTCATCCCT
TTAA

chr11 12,000,074 T A T
ACTTGACGTCTGCCTAGCTG
TCTCCCTTGGTTCCCTTGGA
20
20
20
60.1
132
ATAGCTCTCTCAATCCCTATCCTGATCGCATCTTCTTGATCTATGGGTCCCTTAACTAATTTTTTTGGTTTGACTAGTGGATTTGGCTGTTTTTCAAACC
ATTCATGGTAGTCTGGATGTACTTCTCTCTTCTCACACTCTATGACCATTATTTCAATTCCTATGAGATGACAACTATCCTAAATCTACTTAGCCAATCC
CTCCAGAAGTAGAATCTCTAGTCTGAACTCAAATATAAACTCAACCATATTTTTCATTATAGGAATTACTTGACGTCTGCCTAGCTGACGTAGGACCCT[
T/A]AATGGAACATACGGTTGAACACCCCTAATACCTATTAATAACAAGAACGTCCGAATGACAGAACTATGTATGACTTGCTTCCAAGGGAACCAAGGG
AGATTCCAAGTGATTTTATCTGCCGTTAGAGAACGAAAAAGCTTATCCCAATCTTTAATTCCTTCTAGGCACTTATATTTCACTATCCTTTCCTCATAAT
CCTTGATGTGATTGAATCGTACAGGAACAAATCTCACCACCGTAGGATGTTGATAAAGATGCTCTACGATCCATATCTATAGTAAGATATTACATTTCTT
AAAA

chr11 39,510,877 A A G
CTGCCCAAAGTCGCCAAAAG
GGAATGAGCTTCCCATTTTAACCA
20
24
20
59.53
136
CATCTACCTTTGGTGGAGTTTTCTTACAGCAATAGCTATCATTCTAGTATTGGCATGTCCCCTTTTAAGGCATTGTATGGTAGGAGTTATAGATCTCCTA
TTAGTTGGTTCGAGCTTGGTGAGATGGATATATTCAGTCCAGATTTGGTCTAGCAGGCTATGGAAAAGGTGGAGGTGATTCATGATAGGTTTAAGGCTGC
CCAAAGTCGCCAAAAGTACTATGTGGATATAAGGTATAAAGACTTAGAGTTTGAGGTTGGGGATAAGGTATTACTCAAGGTATCTCCCATGAAGGGAGT[
A/G]ATACGGTTTGGTTAAAATGGGAAGCTCATTCCCCTGATATATTGGTCCTTATGTGGTTTTACGAAGGGTTGGAAATGTTACTTACAAATTGGAGAT
ACCTTCTAGTTTGAACTCCATTCATCTGGTATTTCATGTCTCCATGCTGAGGAATTATCTTGGTGATCCTTCTTCGATAGTTCTTTTGGAGGGGTTGGGT
ATCTCGGGCTCTCTATCTTATAAAGAGGTCCGGATTGAGATCTTTGATAGGCAGGTTCGTCAGTTGTGAACTAAGGATATGTCTTTGATTAAGGTTCTAT
GGTG

chr11 60,108,339 G T G
ACTTGTTATCCTTGTTGACTCGT
ACCATGGACCCTATCTCACCA
23
21
23
59.99
105
GTGAATTGGGCTTATGTATTGTCATTATTATGTTGGTTCCTTGAACATAGTTTCTATGCTTAATTTCTAAAAGTGGTTTCTTTATGTAAATCAGAATGTG
TGATAATTGTCATTGTTGTTACTTTTCTAGATCCTTGAGTGGTCTGGATCAATTTCAAGTTATGCATAACTCTTTGTTTTCAATTATTTGTGTAATTGGG
ACATGATTTATATGATTGTTGCATCATGGATTTTGACTTGGAGTATTATTGGTTGTCATATTTTGATTTAACTTGTTATCCTTGTTGACTCGTATAGAC[
G/T]AAAATTTAGCATGTACTTGTTTACAATGTTAAGTGTTATGAACTTGAAGTAGGATGGTGAGATAGGGTCCATGGTTATCTTATTGAAATACATTAT
TGTTATGTGTTCATATTTCTCATCTTGAGTTGACCGATGAGCCTACCAGTACACTGTTGTTTCATGTGTGTTGATATTACATGTCTTTTTGTTGAGTGCA
GAGCATAGTTTGGCAATTGTTTTGAGACCTCAGTTGTGTTAGTACCTGAACTGAGGCCCTGGTCGAGACAGGCATCCCGAACCATGAAGGCCCAAGAGCC
CTTA

chr11 84,000,016 G G C
TCGTTGTTGTACCAATGCCT
CACGTGCTTGTCTATTGATTGGA
20
23
20
59.32
106
AATGATAATGGAAATGATGTTGATAGGGATGTGATCAGTCTGAGGTTGTTCAAAAACCACTATATACACCTACAAAGTACTGCACCCGAGGTAGGACCGT
TGAGGGGTGTGCAACCCATATACAGTACAATAACCAATACCAATACCAATCTAATATTTATAACTCCTCTCTGACACATGATCCTAAGTAGAGGGTTTTT
AAAAGTGTCATATTTCTATTAGAAAACTTGTATTTTCGTTGTTGTACCAATGCCTTATGAATGTATATATGATATGACAATGTAATAATCCCAACCAAA[
G/C]TAGATTGAGAATTTGGAATCCAATCAATAGACAAGCACGTGATCTAGAATCAACTCAATAAGCAAACCATTCATTATCCAATATAATCCATGTACC
ATTATAATGAGATATGCAAGTAATATGTCATTGATAAAAAATAAACCCTAACTTAGGAATTTTCACCAGGAACAAAACAACTAAAAATACATACACAAGG
CCAACAACATCATAAAAAACCCCACATTGGTTACACATAGCAAATAATGTCCCAAACCACCAATAACAAAACAATAATAACACCAGTTATATTATTAGTA
ACCG

chr11 96,500,294 C C T
TGGTAGAGCCAGTATAAGACCA
AGGGTAAGCTCTTGGAGTTGA
22
21
22
58.38
142
CTCTAATACCATCATGACTCAATTTACTAGTCTTGATGGCACCTACTCTATCCCGCCAATAGGTAAGGCAAATTGTAACCCAGAGTTAAACAAAATGGGT
TAACTTGCTGGAAAATGCCCAACATAGGCAGAAAAATAACAAATACAACTTATAAATAAGCATAGTATTTAAAATAGATAAAGATAGTCAACATAGATAC
CATCTTACGACTTGGTAGAGCCAGTATAAGACCATCTAGTAATAATAATACAACCCAAGTATCTATAATAGTCAGTAACATCTTTCCCAAAATAAAAGA[
C/T]TAAATATAGAAAGATAGAAGGAAATAGATGAGTTCAACTCCAAGAGCTTACCCTTCATAGCAAGAATATCAATCAACGATGGCAACTAGTACTTGG
ATTTGTACCAAAAAGATAGCAAAGTGTAGTATAAGTACAAAAACCATGATACTCAGTAGGCATCATCAGTCGACTGAGCTAAATTAAGATATAAGTATGA
TAAAATGTAAGATAACATAACTAAGTCAAGATATAGACAAACCTAAAGTAACTCCAACATCGCTATGCATGAATAAGTAAGTAAACCAGAATAATGGCAT
AACG

chr11 108,500,078 G G A
CTCGGAGATACCAAGGAAAGCA
GGCCTTAATCTGGTGCTTTCC
22
21
22
59.25
104
GTGACAATATTGTGTAGAACATTAGCTACTTTCTCTAATTCTTAAAATTGATTCATTGGGTCTGACTAAAATAGTGAAAGGTTAATAGGAGAGTCCTTCG
AATATGATTGTAATTATCAGGAGACTAAGAGAAACGATTGATGGAGGCAATATTCAAATTCAACGCACCTACAATGAGGGAACACACTAGAAGATTTTTT
AACTAAGTATTGTTTAAGTTTTGTAGGTACAAAAAGCTTTAACACTTTCTCGGAGATACCAAGGAAAGCAAAGAGCATTGTAATCCTAGATAAGTAGCA[
G/A]AAACCAAATATGAGGATCAAAACACTGAAAAGGAAAGCACCAGATTAAGGCCATTTTAAGAAAATAATCTAAGATAACACTCCCAAAAGAAGACGT
ATTTTAATTTAGCGGAGGTTCAAAACACAACATAAAGTTAAGTATCATCTAATGGCACAAATGTACAGTCCACTATTAACATCGATTTAATTGTAAGTGT
GCTAGTCGGGGTATATAGGTTTAAATTGATAAGAAGGTGGTATTAATCTTTTGAAGATGCATCCTTTCGTAGACAAACAAACATGCATAACAAATTAGTC
CCTT

chr11 113,500,105 C C T
ACTGGGTCCCACTCTCATCA
AGGGGTTGATGTTATGCCCC
20
20
20
59.74
80
AGAGGCACAATATGATAGCACTGTGTCGCGCCATTGGGAAAAATGGGGATTTTTTTTTTCCAGTGGCTTGACGTGATTGCACCACGTCGCGTCGTTATAC
AAAACTGAGATTTTGCAGTTTCCAGTTTTGAGTTTAATTTTCCAAGGATATTTAAGTCCTTTTCCCTTTATCCTATTCAACAAAAAAATGGGATTAATCA
TTATACATAAGGCTATACAAAGTTCTATATGAATACAACCAGAACATATAAAATACGGGGTGTTACACTGGGTCCCACTCTCATCAGCTACTGTCCCAT[
C/T]AATCAAGATTGAATCGACAGTAGACAGGGGCATAACATCAACCCCTGCAGTATCAATAATTGGAGCTCTCGATCCACTATCTCTCATGTCCATTTC
GTGGACCCTTGTCTTGCGGTCCTGCTCATCCTGAATACTCTCAGCATAGGACTTCTTCTCAACTTCTTTGATTTTCTTTGTTTTTCTCTTTCTCTCATGT
ATTTGCATTTGGTCTCCACTATGGGTGCATCAGCCAAGTCTTCCCAGATATTCACCACATGGATCGTAGAAATCACTATCTCTAAAATGGGCTCAGCAAC
CACT

chr11 127,500,100 C C A
TGAATTAGTCATTTAGAAGCCCA
AGTGCCGAATGGGTAAGTTCT
23
21
23
59.37
124
TCATCTTCCTAGAAATAGGGATGCCCAATTGAGATGTTGGGTGGCTTTCATTGACACACTCGTTAGGTACTCGAAAGGGTCAATGAGTGACATCTTTATA
CTTTGTTGACAAACTAGCCTCAAGGACTTTCAACCTAGACTACCACATCATTAACGATTAGAATTTGCACTGAATTATCATGTTCCCATGCATAACTTGC
CCCTAGTAAAGCATAATCCCAAGATCTGTGCCTAATTGATTATACTCTAATTATTTTTAGTCTTGAATTAGTCATTTAGAAGCCCAAAATTAATCATAT[
C/A]TTTGAAAATATTTAAAACCCCTAAGTCTTTGTATCTTAATTTTGAATTTAGTAAGTACTTTCATTTAGAACTTACCCATTCGGCACTTATATTGTT
CCTCATAGATTTGACCCCAACTCTTATTAGGTTATTATATTGACAATGACTACCTTACACTTAAATTGATGTGTAAGTTGAGCTTTATCGGATATTTGTA
GCTTGGGCTGCTCAATAAGGATGTACGAAGAGGTCTTTAGTGGACTAAACTCCACCACTCTACACTTATCCCCTTCAATCACTATAATCATTCACAAATC
TTTG

chr11 151,000,077 T T C
ACTTGATTCAATCCTAACATGGA
CAAGGGCCAAAATCCAGCTA
23
20
23
58.15
150
TTATTACTCCATCTCATTAAAAATAAATTTAGAGGTGAAATTAAGTTATTAAATGTCAAGAATTGTATTGGCTATTCGTAAGATTCACAAATTGAGACTT
GATTCAATCCTGATATAGATTGAATCAACATTTCTGAAGTAGAAGTCAACTATTTACGTTAATATAGTGACAAATTGAGACTTGATTCAATCCTAACATG
GATTGAATGAATATTCTCAATTAAAAATTAATTATTAATTTTGACTATAGTTGTGAAATATTGAGACTAGATTCAATCCTAATAGAGATTGAATCAACA[
T/C]TTTTTGAAATAGCTGGATTTTGGCCCTTGGAAAATTCTTGAGCTTTGAGCTCATTGTCCTAGTAATGACTTATACTAGTTGTATGGTGTGGCTATG
GGTCAGGTGACCCTAGTCGTAAGGTGTCCAGTGGATGGTGGTTGGGTTTTCTATCTTGGTTATGACTTGGTGGTACGAGTCCTTAGGGGTCGTGAGAAGT
CGTTAGGATGAACCTTAAATCAAAAACTTAGTGGCTTGACTTGGGAAGTACGAGTGGCTCACTAAGAGCCGTAAGGATAGGTTATGAGTGATAGGGTTGA
GTCG

chr11 181,030,985 G G T
TCAGTACAAAACTCAGTTCATCT
TGTACATGCCCTACCAAGCA
23
20
23
59.01
128
ATTAACCTGCTAGTTGAGGGTTGATGCATATCTCACCAAAGCACCTATCATTATTGGGTGACTCTTTAGTCCTATGGGACTTTACTTTAGTAGATCCACA
CAATCAAATGTTAGTGCCCGTGGCACGATACTGGCACCCTTCCAACTGGGGTTGTAGGTTGGACCCCAATCTATTCAGAGCGGGGCATGTCAGTTAGATG
ATAACTCCCAAAGTTACAATTTAAGTATTTAGTATTCAGTACAAAACTCAGTTCATCTATACATGATCATGACTTCAAGTTATCAGAAATCAATTATTA[
G/T]AAATTCAGTACTTCGGTTTTAGACTAATTTAGAAGATGATATATGCTTGGTAGGGCATGTACAGTACTCAGAGTATACCCAGTACTTCATATACTT
TCATTCAGTCATTCCATGATATTTAGCGATTATAATCTTGATGTAAGTTATGCATATCAGCGTAATGTCACCTAGTATACCAGTATATTCAAAGTATTGA
TGCATACTTTCTTTGCGCTATGATGTCTCATATCATAGGTTCGGACGCTTTGGTTCCTGACCGTACTTAGTCAGATTCAGTTGATCAGTCGTAGCTGAAG
TTGT

chr11 189,000,068 G G A
GGAAACTCATTAACCACACAAACC
GGTTCTTTAGCTCCTCGGGG
24
20
24
59.82
149
TTATCTTATTCAACTACCTATAGTCAATGTATATCGTCAGGGTACCATACTTATTACTCACAAACAACACCAGTGCACGCCACGGAGAAATACTAGGACG
AATAAACCCTTTATCTAAAAGATCCTTAAGTTGATCCTTGATTTCCCTCAACTCAGTTGGAGCCATTCTATATGGAGGAATAGATATTATACGAGTGTCT
AGAAGAAAATAAATATGAACTCTATTTCCCTATCCATGGGAATACCAGGAAGATTATTCAGAAAGACCTTTGGAAACTCATTAACCACACAAACCGACT[
G/A]TAAAGAAGGACATTCTGAGTTAGAATCTTTAACCTAAACCAAGTGATAAAGACACCCTTTGAAGATTAACCTCTCAGCTCTAAGATAAGAAATAAA
CCTACCCCGAGGAGCTAAAGAACCACCCACCCATTCTATAACCGGTTCACCAGAAAACTTAAAAATAACCTTCTGGGTCTGACAATCTAAAGATGTGTAA
TAGGAGTGTAACCAAAAGATACAACCACATAAGGAGTCACGTAAGAAACAGTGGACCCTAGATCAAGCAAACAATATATGTCATGAGAAAAGAGCTATAA
TCTA

chr11 202,000,055 A G A
GGACAGAATGCGATCCGGAT
AGCTTCTTTCAGTTGCCTCCA
20
21
20
59.86
117
GAGCTGTACAGGTTGCTTTTGATTATGATGATGACGACTTGGATGGGGCTGGTGCCACAGGGGCTATTGTTTCTCCGCCCTTGGTACCCAGAGCCAAGTT
CAATATCACTAGCACCATGATCCAGCTATTGCAACTCAAAGGGTTATTTGGTGGACTTGCAGGCGACGACCCAAATATGCATCTGATTAATTTTATCTCA
ACATGCAAATCGTTTGACAATCCAGGGGTTGGACAGAATGCGATCCGGATGCGCTTATTTCTATTGTCTCTATCTGGAGAGGCAACTCTATGGTTAAAC[
A/G]GGCTAACTCCTGACTCTATTACCAATTGGAGGCAACTGAAAGAAGCTTTTCTAGAAAGATTCTTTCCGCCATCCAAGAGAGCACAATTAAGAGATG
AGATAAGCAATTTCAGACAGATTCCAACTGAAGCTCTCCACGAGACATGGGAAAGGTTCAAGAAGAAGCTTATGCGGTGCCCAAATCATCAGATGACCAA
TGTCCACTTGATGGAAATATTATATAGGGCTTTGAACTCGGTGACTAAGCCAGTGGTAGATAATGCCGCGGGTGGGTCATTCATGGATCTTACATTTGTT
GAGG

chr11 224,500,439 C T C
AGGAGGTTTTGTGGATCTTCTTGA
GGCATCTCCAGTATATATCCCACA
24
24
24
59.28
150
TAAATTTTAGCCACAAACAAAAATATGAAGAAACAAGAATTTTTTATTGATAAACGATTGTGGTTCAAATCTGTTCCTCCCTTAATTCTTCTGTCTTGAT
TTTCTCTGTAATTCGAGGGCCGTTAGTGGCTTATTCTCAAACATAGAATTTGATATGAATTTATCCATAATTCGAGGGCCGTTAGTGGCATATTTCTCGA
ACATAGGAGTAATTGGATTTGATCTCCATGAAAGGAGGTTTTGTGGATCTTCTTGATGTATTTGATTATCAGGAAGAAAGGGTTTTGATCTATAAATAT[
C/T]CCATGAATTTATTGGGACTTTGAAGATAGTTGATCTCTTTGTGAATATCCAATGAAATTGTGGGATATATACTGGAGATGCCTCTTTAAAGGATAT
TTGCCCCCTTTATATAGGCATAATTTAGGGTTTAGGTTGAGTAGCCATCAAGCTAGATTTAGGGTAAAGTAGCCCCAAGAACTCTAACCAAATTTATACT
CTTTTTGTAGAGTCCACAAAATTTTGATGTCTACATACCCGTTCCAAATTTTCTAATTTGATTTGTCATTTTACTTGTCTTTTTTTACTTATCAAGAAAA
ATAA

chr11 227,000,075 A A G
TGAGGCAAAATGTGGATTGAGT
AGCCAAGTGGGAGCTAGAGA
22
20
22
59.96
123
ATTATGACTCATAAATCAGACTATAACAATTAGCGAATTTGATATTGTCAAATTCCTCATACCAGTGGTGCTAATAGTTTGGCAGAAGAAGGGATGAAAT
AGTTTGATGCGATGTGCTAGTTTGATAAGATATGCCTAGATAAGTATATTCTTAATTAATTATTGATGATTTACGATTTGAAAATTTCAGATGGCAAAGG
AAAAAGTTGTTGATTGAGGCAAAATGTGGATTGAGTCTCATAAGAGGAAAAATGGGAGGTTTGAACCTTGAATTTATATCGTAAGTTTTCATAAAAGGA[
A/G]ATTTGGGTGAATCTGATTCTCTAGCTCCCACTTGGCTCCGCCCCTGCCACTGAACTAGAACAATGTATTTTTATTCTATTTAAATTTTGCATTCAA
TTAAATTAAGACAAATAATATGATTCGGGCATTTTCTGAATCTTCTCTATGTGTACTTGCTCATTTCTCCTTATCCCACTTCCCTTAATGTCATAGTGTG
AATTAATTTAGTATTCGATCATGACTTTGGTGCATGTCCAACTAAGATAATTTAAGATGCACATGAGGAACGATATTTCAATGTAAAAAAACTAATCCCA
ACTG

chr12 3,692 G G C
TCCGTACAGTTCGATAACAGTTGT
TGCTACGCATTAATCTAGCTAGCA
24
24
24
60.02
149
ATTATGAATACAAAATGCTAGCTAGATCAATGCGTAGCACGAATTTCTAATTCAGAATCCGTACAGTTCGATCACAGTAGTTAATGTGACTAAAATTTCA
GAAATGTTATTTGAATTACTTGATTTTTGTTGCTTGATTTATAATTCCTATGTAACATTGATTGTTAATTATGAATACAAAAAGCTAGCTAGATCAATGC
GTAGCACAAATTTCTAATTCAGAATCCGTACAGTTCGATAACAGTTGTTAATGTGACTAAAATTTCAGAAATATTATTTGAATTACTTAATTGTTGTTG[
G/C]TTGATTTATAATTCCTTTGTAACATTGATTGTTAATTATGAATACAAAATGCTAGCTAGATTAATGCGTAGCATGAATTTCTAATTCAGAATTCTG
GAAGTTGTTTCGCTACTTGATACTATTGTTTTGTTATTTTCCAGTACAAGTTGATCGAAAATAGAGCATGTCTGACCTCTCACCCAGAGATATTTTTTAT
GCAAGTCCTTATTATATCCATGAAAGGGGTATACCTCTTTTTTTATCTGTGTGCTAATATCAGTTGTTACTATTTGTTGGTGTTTCAACTCCTGCATGAC
TTCT

chr12 16,014,991 C A C
ATAAACCTGCTAGGCGTGGG
TGAGAACTTCATGCTTTTTACCCC
20
24
20
59.48
139
ATGTTATGTTAGAAATTTCTTAAAGTCCCAGATTTAGCTTCATGAGGTAGGAGTGAAGTCTGCGTACAATTTTGAGATTATACTAGCTATGTTGTTGTTG
GGTGAACTCAAGAATTCATGTTGTTCTTTTTGTGATGAATTGCTTAGTTGTGTATAATATATACTGAAAAATGTCTGCTTGTGCTTACATAATAAACCTG
CTAGGCGTGGGTGCAACCTGACTGAAATAATAGTCACAAAAGAACATTGGTATGGAAAGTGTGAGAGCTTACACTTTAAAATAAATAAAGCTGCTACTG[
C/A]TCCTTAGGGGTAAAAAGCATGAAGTTCTCAGTTACTATAATATAATATTTGCAAGGAGAAATAATGTTTAATAGTCGAGTTTAGATCTGGTCTTCG
ACATCTTTGGGAAACTTTTTGAGTGGCTTATTGTTTTATCCAAATCTAGAACTTTAATCTAAATGTAGAGAGCCTTATGCAGGAAAAAAGTAAAATTTGT
TAAGGCAAAAATTCGCTTATGATTTGAGCATAAACAACTTTAAACTCCAAGTGATTGGCAGATTGAAAAAGAAAATGAATGTTTCCACTTTAAGATACTA
ATCT

chr12 35,000,010 A C A
GGGCCCACAGTGAAAAGGTA
AGGAGTGTGTTCTCAGGTGT
20
20
20
58.21
150
CCTTATTCCAAATAACAAATCCTAACAAATTTTATCTTGTTTTAAATATCCCAACAACCTCTCCAATTAAAAAAAGGACACCTCATACCTCACTGCCCAA
TACCCTCCTACCCTACCTACCCACATGACCCCCCTCCTCACATTTCTTGTCCACAAAGAAGGAAAAAACATAGACAACACACATTTTATGAGGGGCCCAC
AGTGAAAAGGTAGCATAGACAATCCATTTTTGTTTCCAGGGAACAAGAACAACATATACTATTCACCTTTCTTCTCAATTCATACAGACATACTCATAG[
A/C]GAAAAAAGAAAAAAATACACAAACACCTGAGAACACACTCCTCTCCATCATTCTTGCTATACGTACACACTCACCATAGATGCATAAACACACAAA
AAATGGGGCAAAATAGTAAGGTATGAGGAGAGTCGAGATCGAGAAAAGAAAACAAAGAGAGTAGTTAGATCGAGAGAGGAAAAGGGGAGAAAAACCGACG
AAAGACATTCTTTCCGGTGAGTTTTCTCGTCAAAAAAGTTATCTCTAGCAACATTAATGCAATTGCAATATGTCAATCAAAGGGTTATGCAGTTGATACC
AGTG

chr12 56,001,835 G G T
TGACAAAGTCTCCCGTGGAT
GCGCAATCACAACAACACGA
20
20
20
60.32
90
TAAAAACTTACTCTCCCATCGTGACTCAAAACGGGCAGACTAACCATATGGCTACTTTAGCTTCACTAATAGTGTATAAAGTGGCCCCACTATTACAAAA
TAAAATGCCATAGGTACTCAGACTTTCCTTGCCTCCTCGAGTCGTTACTCAGTCTATTAATTATAGGGCAAAGGGGAAAATATTGGTTGCAGATAAAAGA
TCTCACATAACCTAACTACACACCCCTAATTTCAAGTCTATTAAATTTAAAATTTAGTAAGTAACAGATATGACAAAGTCTCCCGTGGATAGTAGGCGT[
G/T]GCAGTAGTCTGATGTCGTGATCACAGTAATAGGTCCGGGATCGTGTTGTTGTGATTGCGCTCTATTGACTGCAATTGCAGTAATTGATGCTAAAAT
CCCCTAATTTTTCTCTATTTTACATTACCTGCACATTTATTAGTTTTCCAACTCTGTTTCCCCCAATTTTTCTGAGTAAACTATTTATATTTCAAAAAAG
ACCTATAAAGCATATAAACAAACAAAAACGAATCAAGGATGAGTTGCCTCCAATGAAGCCCCTAATTTATCATCATGGCATGACTATTTTCCATTACCAT
ATAG

chr12 79,024,317 T C T
CCCCTTTGCCTAGTCACCTG
TTTGTGGACAAGGTGTGGGT
20
20
20
59.67
130
TTCGGATATCTTGATTATACGGGCGAAAAAGTGAAAAATACTAGTTTTTATTGATGGCTAGAATTATGGTACCATCAATCAATTATCTATGAAAAATAAG
AAAATTAAGCATCCTTCATCATTAAGGAAGACATCAATTGTGTCACAACCCGACCTCGGGCCTAGTTGCGATGGGTATCTCAAGTTACAGAGGGCCTGAG
ACCATCCCCTTTGCCTAGTCACCTGAGCACAATAAGTAATAATAACGGAAGCAACCCAAACATAATGCGAAAGATAGATAACTCAATAGGAACTAAGAG[
T/C]CAATAAATAGTAACCACCCACACCTTGTCCACAAAAGTCTTTAAACCGAAATACCAAGTTAGGTTGGGAGATGCCCCCGGCCATGGCCAAAGACAA
TCGAAAAGTATGAAAAGAAATCGATAGGATTTCTAAAAACATAAAGAAAGCAGTGAAATATTCGGACTTTTGGAAGATGGAGGCTCACCATTTTAAGCTG
GCCAACGAATAAACCAGAACCACCTAACTCTGCACAAATAATCAAAGAACCCCTAGGACCCTACATTATGAAATGATGCAACATTTGTGGACGATTAGTG
GGAT

chr12 85,508,453 G G A
GCTGTGTTAGGCTGACGACA
AGCTATCAGGTTGGACATCATCA
20
23
20
59.29
124
TTAAATAGTTTACCCTAAATAAGGAAAAAAATTAATAAAAATTAGAAATCCTTTGGATTAGCCAACGACATTTATGATAGCTTATCAGGAAACTGACGAC
TTATCACAAATGTCGTCAGTTTGTTCTTCAGTTTTGGATCTTCCTGCTTAAGGCTGATGACAAACTTGATAACTTATCAGCTACATAACGGCCTATCACA
AAATGTTGTCAAGGCTTTGCTTCAGTTCTCCTTGGCTGTGTTAGGCTGACGACATTCTTGATAACTTATTAGACCCTTGATGGCTTATCACAATATGTC[
G/A]TCACAACTTCCACTTTAGGATGATTCTTTGTCTACTGATGATGTCCAACCTGATAGCTTATCATAGGGCTGATGACTTATCACAAATATTGTCAGC
CACACTTGTCTTCAGATTTCTTCAAATTTCAACTTCTTTGCTTCATTTCATGTTGGTTCTCTATCATATTAGCTTAAACTGTAAAATCAAACATAAACTA
ACAAAAAATAACTAAAGTTGCTCAAGACCTTAAAATTATTTAGAGTTAAAAGCCTCAAATGGTTTAGCATATGCTCACACATCAACACCCTCAACTTAAA
ACAA

chr12 99,501,350 C T C
GGGTGTAGTCTTGGGTTGTGA
AGGATTTTGGGACTGGCACC
21
20
21
60.25
122
GGACCTATCCCAATAGCTCATCATGTTTAGTTGCTATCAGACTGTCCGACGATTAGTATGTTTTCAATAATGACTATTCAGCACCTTCGTCATTGTTTGA
CGTTTAGATATTTTCATAAATGACTTCTACATAATATTTTGTTATTTCTTTAAGTCTTTACAGCATGTGCAAGATCATGGGTTAGCTTGGGTCCACTTGT
GGCCTTAAGCATCATGTCATAACTAGGGTGTAGTCTTGGGTTGTGACACTTTCACTTTTATGTCTATGCATTGTTAAATCCTGGAGCCACACTTTTCTT[
C/T]GTGACTCCATTTATAATAGTAAATTTTGGTGCCAGTCCCAAAATCCTACAAAATTCTACTCGGTTTCTACTCCATTTGGTAGTTCTATCATAGCCA
AATGAGTATATAGAAATTGTGTAGTTAGTGTATCCCAAAAATTCACCTTAGTCGATCTTGTTGTGTCAGACATAACCAATTTTAATATCATTCATGGCAT
GAATAGGCTCCACTCTTGTTAGGCCTTAGTTGACTGTAGAAGTAGAGTAGTCCAGTTTCAGTTTCCCAATGAGCTAGTCATAGAGTGGAAGGGTAGTATC
TCAG

chr12 102,000,609 G G A
TGTTGATGCGTGGGATCCAA
ACAAGACCACTCTCTTTCTTCA
20
22
20
56.97
142
TGTGTTTAAGCCGATTTGAAGCCTAGTTTTCTTGTATTTTTTTATGTATTTTATTATTTCTAGTGTTAGTCCCTTCTTCACTAACACTTATAGAGTCTAG
ATCTAAATTTTGAGTCATTTCCAAGTTGTTTTTGAACTTTGAATGTTGCTGTTTTTTTAGCATTGGTGGATTGAAAGAGTGTTGTTGTGATTGTGGCTTA
AAACTGTTTTGTTAATGTTGGTGAGGGTTGGAGCTTTAAAAATGTGTTGTTGATGCGTGGGATCCAACTTGAACAATAGAACTCCAAGATTCAAAAGTT[
G/A]TGTTCTTGGTGTTATTCACCATCTTCATATTTTGTTGAAGAGAAAATGGTTGTTTAATCTTAGAAATTGAAGAAAGAGAGTGGTCTTGTTATTAGT
CTTGAAAGACACAACTCTAAGACATCCAAAGGGGAAAGGGGACAAAAGGGTTTCAAAAGTTGTCTTTTTAAAAGGGAGAAAGTCCACCTACCAAGACTTA
CAAAAAGGGAAAGAGCCAAAAGTCTTTCAAAAAGGTGTTTAGCCAAAAAGGTGCCAAAAAGTCAAACACTTTTTGAACTTGAAAAAAGGGCTCCAAAGTC
TTGT

chr12 132,002,167 G A G
TCCAAGAAGATGGTGCACAA
GGCGTTACAGCTGCCTCATT
20
20
20
61.03
150
TTATTTATGAAGCAAGCAGAGAATATGTATAGTTGAGGCATAATACATCTCATTCGAGAGAAATGTTGTTTGAAATGTAACAATATACCCACAATCTTAT
ATGAAGATAATGCCGCATGCATAGCACAACTTAAGAGACGATCCATAAAAGGAGATAGAACAAAGCACATTTCGTCAAAGCTTTTCTACATACATGAGCT
CCAAAAGAATAGTGATATTAACATGCAACGATTCGTTCAAGTAATTTATTCAGCAAGTCTCCTTCAATTGCAACTTCCAAGAAGATGGTGCACAAGATC[
G/A]GAATGCAAAGGTTCAAGGATGTTCTCATTAGGGAGAGTTAATACGCGTTGTACTCTTTTTCCCTTACGAGATTTTATCCCACTGGATTTTTCTTGT
AAGGTTTTTAATGAGGCAGCTGTAACGCCCCGAAAATGGATCCCGGAGCGTCATAGGTGCTTAAGGCTATGAGTAGCCCCAAGCTAACCCTTTGAGCCAT
TTTTATTCAGTTCAACACAAATCAACGGGGTTTTCATAAATAACCCTCAAATATCAACAGAGTAATCATCATCCAAGAATAAAAGAATTTCAGAAAGATA
ACAA

chr12 158,510,853 G C G
TGGACTTTCTATGAAAATCCTAGC
TGTCCACGGTTAAAAGGGTCA
24
21
24
59.51
138
AATTCCAATTCCATCATACAAGGTTTTAGTCATGATATTTCATAAATCTTTATCTATTCTAATCAATCCACATGGAATTTATCGTCAAATCATGGAATAG
AAATCAATTCATCATTTATCATTATGAAAGAGATGAATAAAATCCTTAACTTATAGTTAAAAAGGATTCTTAGACTTCATGGATGAAAGGAGTCCATGAA
TGAACACTATGCATACCTTAGATCGTTATTTCGTGAAGATTAATGGTGAAACCTTTTTGAAATTGGACTTTCTATGAAAATCCTAGCTTGAGTTCTTTA[
G/C]AGTATTTGAGAAAAATATCAATATTTTGGATGAATAAGAGATAAATCCCATGTTTGAAAGTTTATATAAAGGAGGGAAATTGACCCTTTTAACCGT
GGACATGTAATTTAATTTTTAGTAAAATTTTCCAAATTGGGCCCTTGACGCGACGCGGCGCAATCACGCCGTGTAACTAAAAATTGACAATTAGGAAACT
GCACGGTGGCGCGACATGGAGCGATCGTATTTCCACCTTGTCTATGACCTGGAAGTTTGGTATAACGCGCCATTATCATGGAGCAACACTGGAATTTTAC
AATT

chr12 168,500,711 T T C
TCCAACAATACCAATTTTGCCT
TCAAATTTCGTGTTGGGGCG
22
20
22
59.69
125
CATTACTACGTGCATAAGCTCAAATTCCATGGTTTATATTTAGACTCATGTGTCATGATCTTTCTCCTAGTGTATGAAGTGATTATGAGGTGAAAAGTGT
TCATAAAAAACACTTGGAGCAAAGTTGAGCTAATAGTCATTCATTCATCCAAAGTTTGATATTCGATTCTACAAGAGTCTACTTTAAACATGTATAACTT
TCTATAAATATAGAATTTTTCATCTCAAGACCATCCAAATTGTATATAATTGAATTATCTTTCCAACAATACCAATTTTGCCTAAAATCGATAATCGAA[
T/C]GAAAACTTATGGCATTTTCCATGTGAGGCAGTAAGCCAACGCGATCTTGACGCATCGCGTCGACTGCGCCCCAACACGAAATTTGATGCAAATTTA
AAGTTTTTTTACACATTATTTAAGTTCCTAATGGGTTTAGAGGAATTTCGATCACTTTTCCTCACCCGAAATCCATATATAACATAGAATTTCAACCATA
AGAAGCCAAAATTGCCTATTATTCACTCTTCCTCTCAAAATCAAAACTCTAACTCCTTCCCCAAAGATTAAGAACTCATCTCTAGGATCAAGAATTCCCA
AAAA

chr12 172,503,315 C T C
CAAGTCGTGATGTGACCCGT
TCGTAGTGGGTTATGATTGGT
20
21
20
56.45
103
GCGAGTGACTCATGACCAAACCAGTAGAGTAGCCAAATTTTCTATCTCTAGTACGACATGTACCTCACGAGTTGTGAAGACTCATTACGATCCATAGGGA
TTAAGTGCAAACCAGCGAGAAATGCACAAGTTTCAGTTGATGTCATAAATGGGCCCTTACTAGTCGTAAGGTGAGGTCACGAGTCATAGGGTGCGACTCG
TGACCAAACAGTAAAGGGGGTCTAAGAGTCTGCCCAGACTACAAGTTTAGGTAATGACTTGTACATAGTTGTCACAAGTCGTGATGTGACCCGTAACGA[
C/T]TGGCGCCCAATTTTTTGCACTTTTAATTGAGGGTACTTACGTTATTTCCCTCTTTTACCAATCATAACCCACTACGATAAAACATCTAGTGAGGGT
TATTTTCATCTCTTAGTCAATCAAAAACTACTCTTAAACTCACTCAAATCCCTAAGGCAAGAACAACTAGGGTTTCTAAGGATTTGACTTCTAGAGCTCT
AATTGGTGATTTCTAAAACACCTTGGGTTTTGGAACCTTAGAAAATTTCTTGGATTTCTGGTTTTTGGTCAAGATGCGACTTGGGGGTATAACTCGTATG
CTGG

chr12 195,500,110 A A C
AGGGAGTTCAACATCTAAGTAGGT
GGAACTGGGGTTGTGATCACT
24
21
24
59.93
148
TTGTCTAGGTTTGAGTGATTGTGGAGACATCTTGATAATTCTTTTTTTATGATTGTTATTTATTGGTTGCAAACAATAGATCCCGCCTTATGTTGATTTG
CTCGAAATGATAAATAAACTAAAGGTAGCGAATTATCAATAAGGATTTGGAAAGGTTAAGCTCCCATTTAATAATTAATGCTGTAACGAGATTGACCAAC
TTGAGATAAAATCAGTATGAATAGAATGATTTCCTAAGTCCGAGAGAATTAGGGAGTTCAACATCTAAGTAGGTTTAGAAACACTTAGATGGACTGTCG[
A/C]AACTGATAATTTGGTGTTTTCCAAAAGTCATGAGAACCCAATACTACAGTTATTATTTAATGGGAATTAATAATCCTAGTGATCACAACCCCAGTT
CCTCTCTATCATTGATTTGAACCATTGAAATTTTAGTTTTGAGATCTGAAGCAAGTTAAAACTTTAATATCTTTTTGATCATCAAAACCCCTATTTTATC
TTTTCGTATCATTTGTTTGAATTCAACTTATAGCTATAGTTTTAAATTAGTTTAATCACCACTCACATTGTTCCTCATAGATTCGACCCTGACTCCAAAG
TTGG

chr12 210,000,035 A A G
TGTTTGGTCTTTAGGACTTTCCCT
AGAGAGGGATTTCATGTGAGTCA
24
23
24
58.9
108
GTTTCAAACTAAAAACACAAATAACTCAAGATTTAACCTGGGTTTTCAACATTGATTGAAGATTTAGAATCCCTAAATCATAGGCTTCAAGAATCATTCA
CTAAATTTCTTAATTGAGGTACGTGGGTTTTCCCAAAAATTTATGGGCAAAGAAACATTCTTTAATACATGCGAATGATTTAGAAATTATGATTTTTTGG
AAAGGGTTTGAATTTTACCATTTCTAGCATATTTTAGACGCTTTAATTAATATTGTTTGGTCTTTAGGACTTTCCCTAAAGTGATTTGAAATCTTATGC[
A/G]TATTTATGTTTTTTAAGTTGATATTTTAATTGAGAGCATGACTCACATGAAATCCCTCTCTTGATATGATTTTTTTCATATTTTATATGATATGCA
TTGTTTTGAAAAGCATGATATGAAATGTCTTGATTTATACCATGACTTGAATATGATTTTGCAATCAAAAGAGATGGTTGTGCTTGCTGATAAATGTTGA
ATTTGCATATAATGAAGGAGTGCATGATTTTGCCAAAAGAACATGACCACCATATGTTTGAAGAATTCTTGCATAGTTTTGACTTATGTTTTGGAACATG
AAAT

chr12 212,501,192 T A T
GGAAATGGTGCTAAGGGAAA
CGAGTGTGGCCAACAAATCC
20
20
20
59.76
150
TATATGTGACATACGACAAGATATTAGGGCATTTAACGAGGGAAGAGAAAGAATAGCAGAGATGGATATCGAGGTCAATTATCCAAAACACTTTTCTAGA
TTATGTTTAGATGATATCGTGTCTGTGGAATCATTTAAAATAATGGAAGAGTGTAATGATGAAGAGCAAGATTCCTATACTGATGATGAGCTTGATGTTG
ATCAACCCTTGGAGATTTCCCAACCAACTGAGCCAACCATGAGGGATGATGCCAAGATTGAGGAAATGGTGCTAAGGGAAAAAGAATAAGCCAAGACAA[
T/A]CTCTTATGAAGACTCTAGCCCAATTCAAAGTAAAAATATTGAGAAGATAAATAAAAGTAAGTGTGTAGAGGATAGTGTAAATTTTGAAATAGGATT
TGTTGGCCACACTCGAAACATTTTTCCACATTATGTTTAGATGATATCTTGTCTGTGGAATCATCTAAAATAGTGGAAGATTGTGAAGATGAGGAACAAT
AATCCTATATTCTTTATTTTACACTTGATAAGCAACACAAAAATACACCTCACTTTAAAGCTGAGTTGTTTACCATGCATCATCCATTACTTGGCATCTT
AATC