Home > Solanum lycopersicum >MAB      


Information

Crossbreeding combination : 258 X     Marker selection method (distance) :
Search

MAB viewer     Marker(#) : 74


MAB marker Information     Marker(#) : 74

Chr. No. SNP position Ref SRR1572485 SRR1572486 Left Right Sequence Primer Size TM Product Size Detail info
chr01 2,255,882 T T C
ACTAGCACAGCCTTAGCAGG
CCATTGAACAGCATGGCAATG
20
21
20
58.72
85
TCGGACTTGCTCTGGGGTGAATAATTCAGTCATTGATACACCCTTTATTGTAGGCTTCCCAGACTTAGATCCACTGGTGCTTTCAGAGGGTGCTGACATA
TTTTCCTGTTTAGGCTGAACAATGTCCTTTTCAGTCTTAACATTTTCCTGTTTCACAAGACAAGCTGCATTACTTGATACAACAGAATCACCATCAGACT
TCCGAATGCAGGAACCATCCAAATTGTCATTTCGTATGTCAATACTCCTGGGACTGACTAGCACAGCCTTAGCAGGAATTTCCATCATTGCGTCAGTGA[
T/C]TTCAGATTTCATTGCCACAGCATTGCCATGCTGTTCAATGGGCTGGGCATTTTGGGTAACGTGAGACTCACTGGCGGTAACTGACATAAAACAATT
TTCAGTTTCCACGATAAGAGATTGAGAAGGTTGCTCAATCTTCGGGCGCTTAACTGAATACTGTAAATCTTCTGTTTGAACTGGCACTGAACCCTGCTTG
GCAGTCAACCTGGAAGCAATCTCACCGGTACCATAGGATCTACAAGTACCATTAGCAGAAGATGGCATATCAGAATTGCAGCCAGGACGAGCAACTTTCT
GTTG

chr01 71,056,329 G G A
GCATAAAACTCAATGCTAGCAT
CTAAATCTTGAAAAACTCCCGTCA
22
24
22
57.45
81
TATCTAGCCAAATGTGACAGATAATGTTTCTTGCTGAACAGGTGATTGTTGCTGCTGCTGAACGTTGTCTTGATCCCATCCCCCTGGAACCAGCCATCTT
GGACAGGCTTACCCAAGCAAAGTTGGCAAAGAATTCGGACCAGAGCTCTACTTCATAATTATCTGGGAGGCTGGGAGCTCAAATGCATCATTCTACTGCG
ACTCTGAGCTGGAAGTAATCAGAAAACATAACACCCAATGCATTTTTTAATAGGTAAAGCATAAAACTCAATGCTAGCATATATTAGAAGAAAAAACTT[
G/A]CTTTAAAGCCTTTCTTGACGGGAGTTTTTCAAGATTTAGAGTCATCGAGTTCAAAATGGATGTAACATGTTATATGTTCACATTTTTTATTTTCTT
ATTACGTATGTGTAAGTGATTCGACTCGAAAATAGTGGATTCAATTAGTTCTAATTGAATCCTCTATAGATATGCATTCACCATAGGTCCATAGCATATG
CATCACTTTGATTGAAAATGGAAGCATTGTCAAGCAACTGAATTCATGGATCACTAGTTCATTAAGGGGCAGCATTTCCAATTGAAAGAAGGGGTACAGT
GGAT

chr01 78,645,772 T C T
TTCCCTTCAGGCACATCCAC
TTGCAGAACTATTCTTCGGTT
20
21
20
55.53
104
GTCTAGACAGATTACAAGCAGAAGCAAATTCCAAAGAGGTTGAAACCTAGCTTCTTGCAAATCTATACACAGCCCCAAAGATTTCATATCTCGATCTGGT
TACTCGAAGACCAGTTCACACTGACGGGTAGAACACCTCCCTGCATAGCCATCCTCTCAGATACATCAGCTAGTGATTTCAGATTGCAATTAATTAAGGC
CTTCACAAAGTAGCAAGTCTCCTCTTTAGTGTTCCCTTCAGGCACATCCACTACAAATGACTCAATCACCAGTGTCCCCGGTCTACCATCAAGTGTCTC[
T/C]GGATGGACTGTAATAACCGAAGAATAGTTCTGCAAAAGTTGATACATTATAACACAAGGTTAGACATGCTAGATGTTTTACTCAGTATTAATATAA
AGGCAGATATAAAAAGCAGCTTAGTTAAGAAAAGACTTCTGGAGATATTAAATTGCAACAAGAGTCTTAAATGAGCAAAGCCGAATGAAAATTACCACAC
ACTACAGGACCTTGGTTCGGGGAGGGTAGTGTGTATGCCAATTCTCGTGTTAACTTAACATTGATATGAACAAATTTTACGATCATGAACAAATTTTACA
TCTA

chr01 81,623,353 T C T
AGGCAATTTTCACCTCTTGA
TGAGATCATACAGCCTCTGATGC
20
23
20
59.99
88
CAGGCATCAAAGTTGCTGATGCTTTTTAGGTCCTTTCAATATATAATCCGATGGTATTCTCTTCTTCTCATATTTGTCTTTTCAGTAGGTATGGGTTAGT
ATAGCACACAAAACAAAAACTAAAATTAGGTTTATATATAAACTAAGATCTGCGAATAGTGCTTTCTCACGATGTTTGGGCCCTTATGTTTTTGCTATCC
ACAATCAAATGTCCAGTCTTGGGACAAAAACTATAGTCTCTTTGTGGTTTTAGGCAATTTTCACCTCTTGATAGATTTTGGATTGAGTTAATCCATGAT[
T/C]GATTTTGCTTCATGTAGCATCAGAGGCTGTATGATCTCAGTAAAAACTTAAGCAATTTGGTGAGCAGGTGCCTGGCCGTAATTTCGTCTTCTCTTT
CTTCTTTTCAACTTTTCAGAATTTAGCACTGCCTCTTTTTGGCAGTGGACCTTACTCTCTTAGCTACTGGCACCGTTTATCTCTTCAATGGATGTTTTAC
TAATCTTTTCTCATATGGTATAAGAGCCTCTACGACCTAAGTAGACTCTTATTCAGCATACCAGGCTTTGATTTTCTTTTCTTTTCTTCTTTTTGGTGTT
CGGC

chr01 81,988,468 C C A
CGACCAACTGCACTTGCTTC
CAACAGGAGGTGACCCAACA
20
20
20
59.82
97
CAAAACACCAAATTTTCTAACTGCAGTCAATGTTTAAATTGTGTATATAGGTTTATCAACCATCTGAAGAGGAGCTTAGGGGTTACCTTGACCCGTACGA
AAATGTATTATGTACAGAGTGTCAGCAAGGTGGGGATGATGCTCTTATGCTACTTTGTGATCTCTGTGATTCGCCTGCGCATACTTATTGTGTTGGTCTT
GGACATGAAGTACCTGAAGGTAACTGGTACTGTGAAAGCTGTCGACCAACTGCACTTGCTTCTTTAAACCCACAGAATCTGAATCCTATGCCTGATAAT[
C/A]GAACAAGCGGCAGTTTTTCTGTTGGGTCACCTCCTGTTGCGAATGTGAGAGAAACGTTTGATCTTAATGAAATGTATGTTCCTGATACCCCTTTGA
CCGAAGAATCAGGTGATTTTCATTCTCCGCGAGATGGTCAAGTTTCTTCTCTAGCTTCTGGGATTGGGGCATTTACAGTTTCTGACCGCCGCAGAATACA
ACGGCAAATACATCAACTCCTTAATAACAGGAGGAGACAACTTGGTAATATTGCTGGGACCTCGGGTGCTGTATCAGGGAATAGTCTCTTTGGCTCTCAA
ATTG

chr02 28,427,191 T T C
TCCACGACCTGCTGCCTGAG
GCCAAGAATTGTAGTTGTGGTGA
20
23
20
59.43
83
ATTTCATTCGAAATTTTTGGATAACTTTTCCCAACAAATTGACTTGTAGTATTCGTAGAGACTTGTGGGCAGAGCAACTAGACACTCAGCTTCTCTCAAA
TCGTAGTTGAAATTCTAAACCAAGTGTGTTCCTTACTACTTCTTAGATTACAAGGGAACAGAAGCGTATGCCAATACAATAAACATAAGAAAATCTCAAC
CACATCATATGAAATCCTGCATGGGTCAATCATCTTCTTACAGGGGGTACAGCACCCCGACCAGGTGCTGCTCCACGACCTGCTGCCTGAGCCTGCAAA[
T/C]GAGATATAATACTCAGCTACATTTCATTAATTCACCACAACTACAATTCTTGGCTAACAAATTCTTCATGACATCCTTCTATTTTTCTACATAACA
TCCTGACCTCCAGCAAAAGAAAACGCGGATAAGAAATCCCACTTGAGTTCTTGGAAGGATCACAACTCCCAACACCAATCTAAAGCAACCAGCAAGATAC
TCATTTATAGTTTCGGTGAAATAGTCTTACTGGTACAAGTAAGGAACATAGTAGAAGTAAATCGATCACCTCCCCTCTCAGTTTTACCGTCAACTACCCC
ACCC

chr02 37,381,272 T C T
TGAGCATGACCTTCTCCACT
ACAAACTTGTACGCAATTTATGCT
20
24
20
58.23
83
ATCAGAAGAAATAATGTGGACCAAGAACAACGAAATCATAGAACTGATAAATATATATCCTGGTGATTGGACTCTCTGCTGACTGCTACTTGTGAGCTGT
TACAACTTAAGAGAAGAGTAACTGAAAGAGTCATTCGACCAAAGATCTGCAATGACAAATAGAGCTAGTACCTTGGCTGCATCCCATATCTTCACAGTTC
TGTCAAAGGAAGATGTTGCAAACACTGTTGAGTGTGGTCTAAAACGGACATCTGTAACGTGGTGAGCATGACCTTCTCCACTATAAACATTGTTAGTTC[
T/C]CAACTTCCAAATCAGTACCTAAGCATAAATTGCGTACAAGTTTGTTAACAGGAGAAATTGAGATAAGGGCTCGCCTATTCGACCAACTAGAATCCT
GTTGAAGATTAATTAGACAAACCTTCTTGTCGTGTCCAGCAGCAGCCAACAACTCTCCTTCTGAATCGAAGTGGCAACATAGGAGCTTGCTAGTGTTTGT
GTGAAGGTTGCTAATCGCTTTCAATGAATTGCCTGCATAGCAAAATGAAGTCAATTATCCTTTATGCCGATATGAGATAACTAGCAATTTATCCATCAGG
GTAA

chr02 38,064,186 A A G
GGGGAGAGGACCGGAGTATT
ACGGGTAGAATGTGCATCTTCA
20
22
20
59.76
83
TATATTCCAGATTCATTAACACCAAAAACCACACCTTGGGTGCTTTCTGTCCCATCCTTTTCCCTGCATGTTGTACATTCTTTTACTTGTCTATCATCTT
GCACTTGGTGTCCTACCACCCCACTTTCAAAGCACGATGAAAACAATCAGGATTATATAGATCATGGAATGTTTAGTTGTAGGCTCCAGTTTTTTTTCCC
TTCCAATTATTTGATTTACTTCTTGAAGCTGAAAGTAATATTTTACAGCATGGTATTTTGTTTACTGGGGGAGAGGACCGGAGTATTAAAGCTTGGGAC[
A/G]TTACTAGTGGAAAACTTGCATATAGCATTGAAGATGCACATTCTACCCGTGTGAAAGGCATTGTTGTGCTACACAAAAACAGTGATGGTGATGCTG
AAGATCATCAACACATAGTAGCATCAGCATCATCAGATGGGGTCATACGTGTTTGGGATGTTCGCATGACTAACAAAGATAAGCCAAATCCACTGGCTGA
GGTCAATACAAAATCCAGGCTGACTTGTCTGGCTGGATCATCCATCAAATGTGAGTCTTCCTTTGCTATTTGAATTTTCCCCTCTTGAAATGTTTGCCTA
ATTT

chr02 39,891,992 G G T
TCTTGATTGCTTGGAGAGACGT
TGAGGCTCAAAACCCATGTCA
22
21
22
59.86
99
ACTTATATCACTAGGCTTCCTCCATTGAGTGAGGAGAATGAGGCGGAGGGGCCATATGCCGTTGTTATGGCCCCCACACGAGAACTTGCTCAACAAATTG
AGGATGAGACTGTCAAGTTCGCACACTATTTGGGTATCAAAGTTGTTTCTATTGTTGGTGGGCAGTCCATAGAGGAGCAAGGTTTTAGGATTAGGCAAGG
TTGTGAAGTTGTGATTGCAACCCCTGGGCGACTTCTTGATTGCTTGGAGAGACGTTATTGTGTTCTGAACCAGTGTAATTATGTTGTTCTTGATGAAGC[
G/T]GACCGTATGATTGACATGGGTTTTGAGCCTCAAGTTGTTGGTGTACTGGATGCTATGCCTTCAAGTAATATGAAACCGGAGAATGAGGATGAAGAG
CTTGATGAGAAGAGAATTTATCGAACCACTTATATGTTCAGTGCTACCATGCCACCTGCTGTGGAGCGGCTGGCTAGAAAATACTTGAGAAATCCTGTTG
TTGTGACTATTGGCACTGCTGGAAAGACTACTGACCTCATCACTCAGCACGTGTTTATGGTAAAGGAATCAGAGAAAATGTATAAACTGCAGAAATTGCT
GGAT

chr02 41,786,529 G G A
ACAAACCTTTCAGTTCCCCA
TAGCGCCGCTGAGCAAATTA
20
20
20
60.46
83
ATCATCAAACACCATTAATATTGTAATGCTAACACAAGTCTAACAACAACAAAATGGATTAAAAATGAGTGTTCTAATTCACAGAAATACCAGCTTAAAT
TTCAAACACACTTGAAGTTTAAACAGAAACAGCTACACAATATCAAGCAAGCAACTAAACCTGCTTTAAGCATGATTTGCAAAACCCAATATGACAATAA
AATCCATTTGAGAAAAGGAAAAAGAATGGTTAAGGGCTATATCAAGAGTAAAACAAACCTTTCAGTTCCCCATTCTTCCCCATCTGGTCAAGCTTCTCC[
G/A]CATATTTAACTATTCTAATTTGCTCAGCGGCGCTAAAGACACCCTTATGTAGCTCCAATCCATCAAGTATATTCACAATTTTCCCCCTCACCCTCT
CCAAACATATGAAATCCTTTTTCCTCTTCACATTACAGAATCTAATGTACTCTCGTTTCTCCCTTGACAATTCTGTTTTTTGCTTACTCTCCGGATTAGT
AATTTCCTCTTCAGCCACACCATTCACCTGACTTCTCAAGGCAATTGACTCACTCACTTCCTCAGCTTGAAGTTCATCCTCCTGAGCCATATCAGCCCAT
GACA

chr02 48,305,259 G A G
TCAGCAGGACATTGTTCAACA
GGCAACATATGTCTCAAATCACT
21
23
21
57.18
88
TACAATTACTTGTAATTGGCTTACAAGATGATTCTATGAAATGTTTTCTCATTTTTCAACTTACTTAGAAGAATCTTTTTACGTTATTGCAACTTATCTT
ACTAATTAATTAGGTATTTGAATGACGTGGACTATTACGGAGGATTCGAACAAGAAGATCTAGATCAATTATTTGAAGCAATGAGATCAAATTACAAGGC
ATGGTGTTCAGGTTTTGCACCTTTAGCTATAGGAGGGGACATGGACTCGGTTGCGGTACAGGAGTTCAGCAGGACATTGTTCAACATGAGACCAGACAT[
G/A]GCATTAAGTGTGTTACAAATTATATTCCAAAGTGATTTGAGACATATGTTGCCTCATGTAACTGTTCCTTGTCATATAATTCAGAGCATGAAGGAT
TTGGCTGTGCCTGTCGTAGTCTCCGAATACCTTCACCAGAACCTCGGAGGCGAATCCATTGTGGAGGTGATGTCCACCGATGGACATCTGCCGCAGCTCA
GTTCACCCGATGTTGTTATTCCGGTGTTGCTTAGGCATATTCGCTTTGATATTTCCGTTGATAAATAGTTACTTTATTTTGGATATGTACAAAGTTAATT
TCTT

chr03 1,779,721 C M C
ACACGGGGTTTGATCTTCCC
TGCTGTCCTACAAGGGGGTA
20
20
20
59.88
80
TGTGGATCACAGAGCCAGAGCCATACCTATGTCGCCGTAGGAGAGGGCATGTTGATTTCGGATTTGGTTGCGAGTTGCAGACTGGAAATGGTGGGCTGGG
TTTCGGCTCGTGGCCTTTCGGGGGATAATACTTCTCTTTCGAGCATTGAAGGTGCCCTGAGTTATGGATTTGAACTTTCTTGGAAACGTACCTTCTTGTG
CAGAGAATGTGAAGCGAGTCAAGGCAACTGTTTTGCTGTGGGTGACCGTTATACTTGCAGCCACCGCTGCTACGATGACACGGGGTTTGATCTTCCCCT[
C/A]CCTTGTAAGTCAAAATTCACTATGTTGAACTCATTCATACCCCCTTGTAGGACAGCATTACCACTAGGTAGAGGGAACTCAGGGCACTCATTTGCT
TCTCTTGGGTGCACTTTTAATTATATTCTAGTTTTGTTTTCAATTTCGCAAGATAGATATACATATATATATATATATATACATGATTTTTTTTTCAAAG
TTAATGGTGGCTGCAAGTGCACCCCACTAACAAGTATGTGTCCGCCACTGTGAAAACTTACCACCTTTCCTCATACTCCACTTGTGGGACTACGCTGGGT
ATGT

chr03 1,889,647 A G A
AGCTATAGCCTTGTTGAACCT
AGCATGCAATATCCACCTTGA
21
21
21
57.7
98
GTTCCCTTTTGTGGTTCAAAATCTTCTTGATGCATTTTAATTGGCCAAATTTCATAAAAAGAAAGACATACTTCTTGCTGTCTTTTTCTTCTTTTTTGGT
TTCCTCTCAAGTGACTTGGTTAAATAAGATAGTTGGTATATTAGTCAAAGCAATGTTCTGAACTCGTCCACCCTAGGGAGCAATGTTTTCCTCTTGTGAA
TTGGTCAGCTTGTACAAACTTTAGTGGATTTGAATTGGTTATTCTGTACTCAGATGCTTGTGAGTTGAACTAAGCTATAGCCTTGTTGAACCTACAGAT[
A/G]TGCGCACAGCTGCTGTTGCGAAGGAAGCTTTGGAAGGACATTCCATATATCAAGGTGGATATTGCATGCTTCATATCTCTTACTCTCGACACACAG
ATCTTAGTATAAAGGTAAAAGCAGCTTTGTGGAGATATTAATTTGTGAAGGAACTCTGTAATTTAGTGTCTGCCATCTCTCTTTTGTTCATTACTTAATA
CCCTCCAGCTTCCCGAGCTTTCTTTCCCCATTTCCTGTGAGGGAACAATTCACTGCCTAATTGAATGGTTATTTTTACTGATTTCAGATTAATAATGATC
GCGG

chr03 56,439,200 C C T
GTGTTGTTACAGTAACCCTTCTGC
TTTCAAGTCGCCATGTGGTG
24
20
24
59.05
82
TGAAAGTGCCACAAATTTCAAGGGTGCGTATATCGAATAGATTGTGCAAGTTGTCTCTCCCACTGGTTAATATCATGTTTCCATTCCGAGAGAGTGAAAC
TGATGTAACAGCCTGTGAATGTGCAGCAACTTCACTCAGAAGCTTGCCTGTTTGAACATCCCATAATCTAAGATTACCATCAACATGACCAGAACAGATA
GTCAGGGCATCCATGCTAAACGCAAGACTGTTACAGTTACTGTGAAATATGATAGTGTTGTTACAGTAACCCTTCTGCAGATCCCAAACTTTTATTGTG[
C/T]GATCATATGCAGCACTCACCACATGGCGACTTGAAAATTTGCTTACATCAACTGCACAAACCTTGTCCATGTGCCCAGTAAGAGTGTGCCGTATCC
TGCCTGAATTTGCATCCCACACATACAAATTATTTGAACTACTTGCTGCTATGATGAATTTGTTATCATGTGTAACGGAAAGATCAAGAACAGAACCCAG
ACAACCATAAAGACTGTTGGTTAATGATCCGCTTGTGGTATCCCACATTTTAATTGCTCGATCCTGACCTCCGCTTATCAATTTACTTGAGTTATACTCA
AAAA

chr03 64,291,488 A G A
CGCAGGGGTTCTATCTTTGGA
TCATGTTGATTTCTTTTTCATCCA
21
24
21
55.52
81
ACCAAATAGTGAGACATGATATTGCAGTACACTTTCCAAAATATGATTTGACTTTGGTTAAATGTATCATAATGACTTCACCTCACTTTCGGCTAGCAAT
TGCTCCAGTGCCTTTGGTAGATATGGAAATACAGATGATCCCAGTATGTCCACCATGCGGTGAATGAATGATGTGACCTAGGAAGTTAACATCATCAGGT
AAGGAAATGCATCACCAAAGGTGCATCAAATAGAACAAAAATAACAAGAAACCATACCTTGCACCGCAGGGGTTCTATCTTTGGATATATGATAAGAAT[
A/G]CGTAGAAGGACATCCAATGTCTGGATGAAAAAGAAATCAACATGATAAGAATTGATGCATAAAATCAATAATTGGATTAGGGCATTATTTAACCAC
AAAAATTTAAAATCTGTCTCCCTACAACGGGTGCACCAGAAAAACAAATACTGCAAAAAAAGGAAGGGGAATAACAACACACTTTGTCATTCACTTATTC
TGAGAACAAAGTAAACAACCAAATATCCATTGAAGTATAAAGACAGCCAATCCAGATACCAGCCTCCTTAAATAGTGACACTACTGAGAGGAGAATATTC
AGGA

chr04 1,041,213 T T G
TGCTTGCTTTCCTACGACGT
TGGAAAACCAAACCAACCTGA
20
21
20
58.18
80
AGTAAGTTACCAAAAAATAATACTACTATAGTAAGTAAGTACCCATGTTTTTCACCACCAGAGCATAAGGAACCATCAAACAACTTGAGAATTTTGGCGT
GTTGCATACTGAAAAATAGGTTCTTTTACCTGTAGATAGAAAAGAAAACGGGAACAGAAAGATAATTATAAATATTTCCCAAATACTTCACTTCAGCTAG
CCAGGATTCTTAACTAAGATTTTCTGGATAGACTGATGGATGTCATACCATGCTTGCTTTCCTACGACGTTTGTCCTGACTGGACCTGCTACAGACAAT[
T/G]TCGTACTCATCAGGTTGGTTTGGTTTTCCATTAATTCTTCCATTCTCCTTGCCAGGAATAAAACTCTCCCGAGAAGCTACAGGCTGCACAAACATA
ATATATAGTTATTTGTAACTTACTGTAGTCTGTTAGGTGATCAACTAATTAATTACTGAAGATTATTGAGGTAATCCACAAATAAACCAACCTCAGCTTT
GCTTGATGGTGTGTTTTCATGCTCCTTTCTCTTGGAGACAGTCTGATCACTCATGACAGATCCATTCCGGTATGCATCAGCTTTTCCTCTAGTACGTGTG
AGAT

chr04 3,636,527 C C T
TGCAGAGTGGCTTTATGCTCT
TGACATAGGCCAAGAGGGGA
21
20
21
59.96
80
TGAGACTGCCAGAACTTCCTAAGATTGACGTTCAATCTGCAAATCGGAAGTTGTCCAACAATTCCGATCCCGAATCACCTGTCTCACCACTATTGACATC
TGATCCCAAAAATGAGCGTTCTCACTCACAAACTTTTAGTCGTCCTAACAGTGAGTTTGATGACTTCCCTAATACATCCGAAGAAACAAAGGATACAGAG
AATCGAGAACCACCATCCTTCTGGAGACTTGTTGAGCTTAGCCTTGCAGAGTGGCTTTATGCTCTACTAGGGAGCACGGGCGCTGCAATATTTGGTTCC[
C/T]TTAATCCCCTCTTGGCCTATGTCATTGCATTGATTGTAACAGCATATTACACAACAGATGATAAACATCACTTACAGCGAGATGTTGACAGGTGGT
GCCTCATCATAGCCTGTATGGGTGTGGTGACTGTATTTGCCAATTTTCTGCAGCACTTCTATTTTGGTATAATGGGAGAGAAAATGACTGAGCGAGTTCG
GAGGATGATGTTTTCTGGTAATGACTAATTTCAATTAGTAACTGTTCCCTTCATAGTTTGTTTTGTTTTACATTTGTACTTGTGTAAATATATGCACTTA
TAAT

chr04 7,791,162 T T C
CTTCATTGGAGCCCCCTGAT
TCCCTTAGGTCCTGCTCACT
20
20
20
59.59
88
TTTATTAGACAATGCTGGAGCGCAATCATTTTTCTCATACTCCAAGAAGCTAATACTGTACCGTTTACAGTTTGAGATGTCTACCCTCACTGTGGCTAGA
TTAGTGACATCTTGTTGCATCTTCTCTTTCCTAATGATCTTCATTAACTTAAAAAAGCTAGATTACTATCTTGTTCATATTTTTGGCTCGAGAAGTGTTG
TCATTGTGTTACCTGCAATGCTTGCAGAGTTAATGATCCTGTGGCGATGAAGCTACTTAATAAAGCAGGTGAAATGCCTTCATTGGAGCCCCCTGATGA[
T/C]GAGAGCATTAGAACCCTCTATGTGGGTGGTGTTGATGCAAGAATCAGTGAGCAGGACCTAAGGGACCAGTTTTACGCACATGGAGAAATCGAGTCG
ATTAAAATGGTGTTGCAGCGTAGTTGTGCTTTTGTAACCTACACTACAAGAGAAGGTGCAGTGAAGGCAGCTGAGGAACTAGCAAACAAGCTAGTGATAA
AGGGCTTGAGACTGAAGCTGCTCTGGGGGAGACCACAAGCTCCTAAACCAGACACCGAACTGTCTGATGAAGCACGTCAGCAGGCTGCAGTGACTCACAG
TGGA

chr04 16,131,381 C T C
GGTTCAGATAGCCAGACGAGG
AACATCAATCGCCCGACTGT
21
20
21
60.04
99
CGATCCCTAATAGTTTCTTCGGTACAAGGTCCCTTTTGCTACTTCTAGTGTGTGCGTGAATGTACAATGTTGTGCTTTTTAATCTTATTTTTATTTCATG
CAGCTATTTGTTCCTGCGTGTACAAGACTCAGTATTGAAGGCATTGTAAATATGTTGAAGTCTTTTAACTGTCAAAGAGGTAAAATGGGTATAAAGAACC
TGTGGATTGGCGGTCTTTATGGAGTGATGCGTGAGCATTTTGAAGAGCTGGAGTTTCTTCTAGGTTCAGATAGCCAGACGAGGCAAAATGTTTACAAAC[
C/T]CCATTTCTTTTCTCGAAGGAATATTTATCGTTTGGCTGATGACAGTCGGGCGATTGATGTTCAACTATGCCCTATGTGTAAAAAGGTAAGGTTGGT
CTATGATTGTCCTGCAGAGGGTTGCCAAGTGAAAGATGAAGCTATTAAAGAATGTAGGGCCTGCTCACTTTGCATCTTACGGTGTAGTGAATGTGGGAGA
TGTATAAATAACACAGAGTATGTGGAGACTTTTTGTTTGGAATTGCTTTGTTCTGATTGCTCTAAGCAGCCTTTGGAGTGCAAAAATGAGCAGAAGTGCA
GCCT

chr04 21,084,365 T T C
TGACCCAAAAGATATATTGACCAG
TGTGAGGTGAAGCGATCTGC
24
20
24
60.39
95
AATATAACTTAATTAATAGAGTTTGAACCCACATCATTGACCGCTAGGCTTAACCTTTGAGTGCGTTAATTTCTCAAGGCTAACGAGTGCTTTTGTAGGA
GAATTCAGTCATGAAAGGCATATCATATGCCTTACAGGATAGTAATATATCAGCTTAAAATGATTACATATAAACAGGGCATTTTCCCAAAAGAGAGATG
GATCAGTTTAATACATATACATGTAAACATACTATTGACCCAAAAGATATATTGACCAGTTTCTGGAGCTGATAATATAACAAAAACATGCCATTTTAC[
T/C]TACTTCATATGCAGATCGCTTCACCTCACAGCCAGATATTGCACAAAATGACAGCTCCTGACATCTACTCCATATAGTTAGAGGTGAAGCATATCA
GAATGAGCCTTCATTCCCTATTTGGTGTTAGCTCTTCTCCTTCTGGCACTAAAGTTTGCATCAGCTGCGGACAGTTTAACATGGTCAACATACAACATCC
AAGTGAAGGAAGGAGATTACAGCAAAAAACGCTACTAATGAATATTCCAAATTCATATACTTAACACTATGTTAACGTTACGATACCTTCCAATCATTGT
AATC

chr04 22,173,274 G G A
ATTTTCTTTGGTGACGGGGG
CAGCTGTAAGAGATTTCGACTTGG
20
24
20
59.67
81
TAGAGTATATCAGATCTCAGTTGTTTTCCAACAGGCAACATCGTTTTACCCTCCAAATAAAGGGGGAAACGGAAAAACCAGAGAAAATCAAAGAAAACAA
AATTTGCTTAAGATAAAAATAACTTCATCATATCCTCACCCCCAAAGCTGTGTTTCTACTTGAAGACACCATTTCCTTAGTTATCAACCATGTAATCATA
ATATGGCACATTTAAATTACCTCACGTTACAGCAGACAATTGAAAAAAAGAACTTGTATTTTCTTTGGTGACGGGGGGGTGAGGGGTGGAGCAACTCCC[
G/A]TCACTAAAACTTTCCCAAGTCGAAATCTCTTACAGCTGTAGAGATACATTACATCTTCGCTCAAGTAGGATGCTACTTGTACGGCCATTTTGCTAA
ACCCTTTGGTATTTGTTTCCTCAACAGGAAACCGATCCAAAGAATATCTCAGACCAATGAAAAGGAATCCTCACTGTCCAGTATTACGGGATTGCAATCT
CTTCCTCTCCAATTCAAGCTGAATGGAGAAACCAGGATGAATGAATTCAAGTGACCACAAAAAAAGGATTAGTTTTTCTTTGATTTAAGAATATACACAA
GTAT

chr04 27,044,795 G G A
TTTGCAAAAGTTGTGACCAAT
GGAAGAGCCTGATAACCACT
21
20
21
56.62
92
GACGTATGAGGTGATGAAGTCAACATAACCAACTTAAATGTGTAGGCCTGATTGTCCCTGCATCCTAAAGAAGAGAACCAACAATTGTTTGAGTCTTAAC
TCTTGAACTTAGTATTAAACGTCTCTGTCTGATCTTGTTCTTCTGGTTGGTGGCGGAAAATGTGATACAATATCATGCCTTTTATGACCTTTGTGGGCTT
AGTTTGGTGAATTTACCGCACCGACAGCCTTAATGTAATTTTATTTTTTAAATTTCCTTTTAGCTGGAACCGATTATTTGCAAAAGTTGTGACCAATGT[
G/A]GGATCCTCTAATGCATGCTAGGTTCGCTACTTGAAGATAATTGAAAAAAGTGGTTATCAGGCTCTTCCTTGGGTGCGATATATTACCATGGCTGGT
GAATATGAGTTGAGACTTGCGTAAAACCACACCGAGATGATGATCCAATGCAATTAAGTTTGCCCGAGGCTCGGATAAGTCACGAGCTCCAATGCTTTGA
GCTGTTTTTCAGGAGATGAACTGGTTTAGCTCATAGATTTTAAGCAAATTGTTTTGTTGTGCCAATTTGTTATTTATTTGACTTTATTACTTGTATGCTA
GCCA

chr04 28,635,778 C C T
ACTTGGTTTCGAACTGGTCT
GCCCTGACCTCAATTCTGCT
20
20
20
60.03
150
GGGGTTAACAAAGAAGAGGATGGTGTGTCTACACTATGATGAGACCGACCTTTGTCCACACTAGTAGTCGAACTTGTTCTATCAAGAATTTTCCTGTTAC
GTGGTCTTTTTGTCCTGCAAAAATTCTCCTCTGGCTCCCCAAAGGCAGAACCAGGCACGTCATTTGCATACTCGACGTAGATAGGGTGGTCAAAAGCGGT
TTTCCAAAACATTGCCTCGACAAGGAAAGGAGAAATGTCCTTAACGATGCCGAATTGAGTCCTGGCAAAGTTCTTGGACTTGGTTTCGAACTGGTCTAG[
C/T]GTATAAAGTTGTCCACTTTGCCAGACTTGCTTCTGTGCTCCAAATGGGAATTTCTTCTTTTCAGTATGACCCAATTCCTGATGTCGGGTGGTAAAA
ACAGGGGCACCAGCAGAATTGAGGTCAGGGCACTTTGATAGAGAGTTGTTCAAGTTATGAAGGACATACTTCTTTGAAGGTTTAGGCAATGGCGGAATGA
CCTTACATATACCAAAAGCACTAGCTTCCTTCTCGATTTTTGATATATAGGCAATGGGGTCAGCAAATTCAGTATCAGTAGGTCGAAATTCAGGTGCGAG
GGGC

chr04 31,103,944 C C A
ACGTCTCCTCTCTATAGGCCA
ATGGTGGCAAGGACACTAGC
21
20
21
60.04
138
TACTCGGATTCATTCTTTATCCTGTAACAAATTGTTGATCATATTTACTAATGGAACAGTTCCCTTTGTCATTATCTCAAATCTAGAAGTATTTGAAGCA
TGAGAGAATAGAGACAGCCCAAAAACTATGAGTTCAGGTAGAAACAATCGAGACGATAAGAAGCCATGCCAATAACGAGGTTCTAAGTCAAAGAATGCAT
CAAAGAACCTTCTTGTAGCAGGTAAATCAAGCTTCAGAAGAATATCCATACCGAAGCAGAAGAACTCTCTTTGACGTCTCCTCTCTATAGGCCACAAAT[
C/A]TTTCCAAACAGCTGTGGATAATTCATTACCCGAATGACTTCTTTCAGAACCGAGGTATTGAATTATGGCATTGGCAACAACAGGAGCCGCAGCTAG
TGTCCTTGCCACCATATAACCGGTGGATGGATGAACCATGCCAGCTGTACCACCGATTCCAACGACTCTCTGAGGTAATACTGGAAGTGGACCACCCATT
GGTATTAGACAATGTTCATCTTCTTCAATGCTCTTCACTTTTATCCCCAAATGGTTTAAACGAGCCACCATTCGTTCTTGAATATCATCTATACGCAAGC
CAGG

chr04 44,896,501 G G A
ACTGATATTCTGGCTTGCCT
TGTGGCCTCTGAATCTCAGC
20
20
20
59.75
89
GGAAATGCTGGTCTTTGTGGTGGCATACTTCCACCATGTTCTCACAGTCTCACCATAACTTCAAATGTGAGAAAGAATCGTGTCAATCACATAATCTTGG
GATTCATTGTTGGAATCTCAGTTATCTTAGCTGTTGGGATCATGGTTCTAGCAGGAAGATGGATGTACAATAGATGGTACTTGTGCAACAGCTTTTTCAA
GAAATTTCGGTTCAACAAGAACAACTCAGAATGGCCTTGGAGGCTTGTAGCATTCCAGAGGCTTAACTTCACAAGTACTGATATTCTGGCTTGCCTAAA[
G/A]GAGTCAAATGTGATAGGCATTGGTGGCAATGGAATTGTCTACAAGGCTGAGATTCAGAGGCCACATTCTGTTGTTGCAGTTAAAAAGTTGTGGAGA
TCAGATGGAGACATTGAAGCAGGAGATGATCTCGTTGCAGAAGTCGATCTTTTAGGGAAGCTTCGTCACAGGAACATAGTTAGGCTACTAGGCTATCTCC
ACAATGAGACTGATATCATGATGTTATCCGAATACATGCCTAATGGAAATCTTGGAGCTGCTTTACATGGAAAAGAAGCTGGAAAAATGCTCATAGATTG
GTTG

chr04 45,680,985 C C T
ACTGATGCACCTCCCTTTTCA
GGTGGGTATAGAGAAGGCTGT
21
21
21
58.6
111
ATATCACGATTTCGAGCTTTATGTGTATAATTTCACGAGAAGGTTTCAATGGACAAAAAAAACATGGTTAAATCACCTTTTACTCCGAGACAATGGACTC
AAACCATTACTCGGCTTTTGCTTTTTCATTTCCATTTGTATTTGCATGTGGACCACATGAATGATTTTGCACTGATTGAAATTTAGAATCAAAGCTGCGG
TAGACGATGTGCTGCTATGGGAAACCCTCAATGACTTCAGTAGTGCGTGGAATTACTGATGCACCTCCCTTTTCATTATCAATTCTTCCACAGCACCTC[
C/T]GGCCATTACCATCGTTTCGAGAAAAAGATTTCCATCATAGTTGTACAGCCTTCTCTATACCCACCTGAATTTTAATTCCGCACTCTCCGTCTTGAA
TAAAATGTATAACTGCGTTTGGGCCGATGAGGATCGAACTTGAATTGTCGCCCATTTCAAATGTTCTCTCGTACGTGTCACATCATCTAGACTCAAAAAA
CCCCTACAGTGCTTTCCAATAGCTCAGATAGTGTCTCCCCGCAACATATGTGCCAGGAAGTTCTATCGAATCCATGTAGTTGGCAATATTATTCTTCAAG
CATT

chr04 46,729,714 G G A
TCAAAACTGCACAAGACATGCT
CACAAGCGCATTCAGAACTGT
22
21
22
59.73
80
TTGGACAATGAAATGGTCAAAGCTGTTGCTGCAGTTGTCTTCAAGGGGCACTGGGACAATCTTTTGAAGCCTAAGATTGGTTCATCTGTGACTTCCACCA
CTATTCGCCAAGCTCTTCTTCATATATCACAATATTATTTCTCCCTCTCATGGTCATTCTTTCAGTGGGCTGAATCAGTTCCCAGTCACAAGCATTCGTT
GCAATCCTCTTGGACTATGATGTACATACTCACCAAACAAAAACACTTCAAAACTGCACAAGACATGCTTCAGAAGGTGGCGGTCAAAAACTTTTTATC[
G/A]TCACCGACAGTTCTGAATGCGCTTGTGAGATCTAATATGAATAATGATGTGAACTCACATCTTTTAAGTTGGTTGGTGATATTCTATGCTAATTCA
AAACTACCCCATGATGCAATTCAAGTTTTTGAGCATATGAGAGTTTGTAAGCTTATGCCCCATACACATGCTTGTTCTACCCTTCTGAATTCATTGGTCA
AGGATGGGTTGACTGATACTTTGTGGAAAATTTACAAAAAGATGCAAAAAATAGGGGTCCTTCCAAATATCTATATCTATAACGTGCTTATGCATGCCTG
TTGT

chr04 57,326,657 C C A
AAGTCACAAGGCCACGAACA
AACTTGTGTTGCCTCGGGAT
20
20
20
59.89
92
TTGGTAGACTATGAAGCAACGATTTTGATTTGGAAGATCGACAAATTTGATTTTGTTGCTTGCATGGGAGCATTTTTTGGTGTGGTTTTTGCCTCTGTTG
AGATTGGTCTTATAATTGCTGTAAGTATTTCTCTCAGCAATGCTTAACAAATTCATCAGGGAAAGCCGCGACAGTTCAATGATTGTATCTCGTTGTTTTT
ATTATTATATAGGTCTCAATATCATTTGCTAAGATTCTCCTCCAAGTCACAAGGCCACGAACAGCTCTTCTTGGCAAGATCCCTAGGACAAATGTATAT[
C/A]GGAACATTCAACAATATCCCGAGGCAACACAAGTTCCCGGTGTACTAATAGTGAGAGTTGATTCTGCTATCTACTTTTCAAATTCTAACTACATGA
GAGAGAGGTAAGACATTATTTCTTCTATGTCTAATCAGAATTTATATGATATTCAATTGTCAACTGAAAACATGCACTAATTCTGGCTTCATAGTGGCGA
AAAGAGTGTCTGATTCATGAGAATGAACTTGTTTTCCAGGATATTGAGATGGCTAACTGACGAAGACGAGCAACTAGAATCAGTTAACCAACCTAAAATT
CAGT

chr04 59,232,566 G A G
CGGGGTCCTACTAATCCCCA
CCTCCCAACAGTCCATGGAC
20
20
20
60.04
80
CACCATTGCTTTCTGTATCTGAAAACGAAGAAATTGAACACTGTTCCAACGACAATCCAGCTGTTGAAATTCAATGTTGTTGCTGGAGGCATACTGGCTG
TAGCTGCAAGAAGTACTGGAATGTTGATCAATTTAATCCAACTTTGCCTTGGGAATGATTTGTGCAGCAACCACACCAAAAAAGGTGCCACAAGACCTCC
AATAAAGCACCAATTGAGGGCACCATATTCTCCAAGGCCTAGGAATATTCTTCGGGGTCCTACTAATCCCCAGATAACTGATGCATCAAAAAAGACTCT[
G/A]TCGCTCTGACAGGTCCATGGACTGTTGGGAGGAAGCAAGTTAGGTTGGCATATGTGGTCAATGCTATTAAGTAGCCACCATGCGACACCCATATTG
ATTGTACCACCAAGTATGGTTCCAACAAGCTGTTTTAAAAAATAGAAGTTTTAGTCGGTCTCTTGTAGCATCAAGAAACAGTACAATTGCTATAGTTTCT
TCTTCTTCCTACGATCAATAGATTGGACTCCTTATGTGTCCAACACTAACCATTGACTAGTATAAGTGATTAATACTTCTAATGGAAACAATTGAAGAGG
AAGA

chr04 61,310,401 C C T
GGTTCTTCCTGCAGAAATTCGA
TGTTGTTGAGTGAAGGCGGA
22
20
22
59.82
80
ACGTTGTTGCATACGAAATTTGAGCTAAAGGTGTTCAATTACAAGCTTTCCAACATCCTTATTCAGAAGGGTCATACCTTGAATTTTGTTGGACGAATCA
AATGGAACACGATTGTATCTCCATCGGCCAAGTCATGATCCACAGAAAACCTCTTCCATCCACCACTAAGTCCAAATTTTTGAGCCAAGTACACAGTTGG
CCATTCTTCTCCCGTTTCATCGATTAAGGTGATAGTGTCATCTCTTCTTGGAAGGTTCTTCCTGCAGAAATTCGATGGGAGACCCTGCAGCATGAGTTG[
C/T]AAATGAGTTACTGTCCGCCTTCACTCAACAACAATTACAACTACTACTACTACTACGGACAATCCTAAGCAAGTCGTGGTCTGCAATATGGATCCT
CACTGCACATATCGCTCTATTTAAACATCCGTCTATTCATATTTCATTCTAAATCAATACTATGATCAAATTGCATCACTACAGAAAAGAATACAAAAAG
ATAGCAACAATATGATCTTCATTATGTTGGCATTGGGCAATAACTTTATCAAAGCTTAGTACATTCTGAAGTTTCCTAATTGTAAACTTCTTCTGATTCA
GAAC

chr05 472,887 A G A
TCCAAGCACAAAAAGGTGAATGT
TGCGTACACTCTATCCTCCCA
23
21
23
60.06
124
TGAGAATACATGACCAAGCCAAATCATAGTTAAACAACAATGACAATGGTTGAACCAAAGAAATTGAATCACTAATAAAATTGATCAAGGTTCAACTGCT
GAACCAAAATAATAAGTTACTGAAAAAACTGAACTGAGCGAATTGGATAACTTTCAAAATCAAGTTTCCTCCATGAACAATCTCATATTCTATAGGTTTT
AAATCCAAGCACAAAAAGGTGAATGTACCAATATCATGCTGCTAATCTTATTGCACCTCTGATCAACAACAAAAACATATCCCGTAAATCCGACAAAGT[
A/G]TGGTCTTGGGAGGATAGAGTGTACGCAGGCAGCAGGCAGACCTTACCCCTACCTCGTGGAGGTAGAGAGGTTGTTTCTGAAGGACTCTCGGCTCAA
GAAGCAAAAGAAAGGAGAAACGAAATTTGAAGGAAACATGACAACTAACAGATGTCATGAAGCAATCGCCTAAGCATAATAAACAACAGAAAGTAAAAGA
TGACAAAAACAAGAAACTACATGAATAACACTATCACTATAACAGACAAAGTGCCCCAGAGGCCCAGACTACCAACAAGGCTAATCCTGTCAGAAGCAAG
ACAA

chr05 2,070,005 T C T
GTGCTCTCCCCATACCTTCAC
CTTATGCAGCAGTTTAGTTGC
21
21
21
55.87
82
ACCAACTGGAATACCCCCTGAAGTCTACATACAGATGTAACACAAGTAAGAATAATTGTAAAGAACGAAGGAATGAAATTACAAGATTAAGGTACAAGTG
TCACCATATTAGGTAAAAGAAGAGCCAAAAGTTACTAGGTAAAGGAGAATCCTACATGCTATGCAATTCAAATTTAGCTGCATCCTCAATATTTCACACA
TACCCATTGAACTTAAAAGCAAGATCATTGAACTATTTATTTTTTGTGCTCTCCCCATACCTTCACTAGAGGACAACCCAGAGCTTCACATCTGTCGAA[
T/C]ATGTGAGCAACTAAACTGCTGCATAAGCAAGATATCTAAAAGTATGCTCACTCTAAGGTGCTGAAAACTAGACTCCACAAAGTTACGCAAAATTAT
GACTAACTATATAAAGGAATACAGCAAACTACTAGATACCCATTTGATACATTTTCCAGACGTCTGAGACATGAAAAATGTAGGCTTTTTGACCACTAAA
TACAGCAAGACGAATCAAAAGAGAAATCAACCTAATTGATGTACACATTTGAGATTTTTTGGCCTATTAAGATATGACACTTAGGCCTAACTCAACTCCA
AAAG

chr05 41,689,619 G T G
TCCTTAACACGGTTAGCAAATGC
ACAGGAATATCTTGCTCCAGAGA
23
23
23
58.71
95
CTTCCCCTGACCCAGTGTGAATGGGGATGCTTCATGCACCGGGCTCCCCTTTTTTATACACTCAGTCAACCAAACATTTTAACCATATCATTATCAAATT
TTGAAGTAAGACTTCTCTTCTGCAATTTCATCAAAAAGCTCACCAGAAACTGGAAGGCCAACCTGCCAAGTGACAAAAATAGAGCAGGAATCATCTCAGT
TAACAAGTAGTGATGCTCACCCTTTTTAGTGCCTCTATGAACAACCATGCAACATCTGCACCATTATTCCTTAACACGGTTAGCAAATGCTTAATAACC[
G/T]CAGATACACTTGTCCCATGCATTGAAAGATGAGATAGTATCTCTGGAGCAAGATATTCCTGTAGATATTACAGTGATGAAATATGTTAGCACCTGA
AAAAGATAATCAACGGTATGCCTCCTAATCTTTGCTTTCTAAATGATACTGCAGTAATACAAAAAAAAGCATTGCCAAAATCCACATAAGAAGTACAGCT
AGGAATTAAGTATAGAAAAGTACAACTACGAAAAGAGAATACACCTAACCTTAGGAACTGCATCAACAGCAACCAACTTGCCAACAGCAATGATTACAGC
ATCT

chr06 35,102,133 C C T
TTCCACACGCCTGATCTTGT
GATCTGCGGTGTTGCCAAAA
20
20
20
59.69
89
AGAAGGACGTAAGAGGTTGGAAGATTTTTAAAATCTACTATTGTCTCTTTTGAATTCGTAGAATTACCCGAGTCTTCTCCAAAATGTATTTTCTCTTCTG
GTTTTATAGAATCCACTCTGTCAATAATATCGTACACGTCCTTTCCGGTTAATATCAGTAAGAGAAGAATCCCAAAGCTGTAGACATCAGTTTTTTGAGT
ACTAATACCTGAGGCTAAATTTTCTGGAGCTACATACCCCATTGTTCCACACGCCTGATCTTGTACCTCCAATTCCCCTGGAGGCAGTGATATGGAGAG[
C/T]GAGAAGTCTACTATTTTGGCAACACCGCAGATCTCATCAATTATCACTTTAGATGACTTTATATTTCTGTGGATGATTGGCGTAGTAAATTCAGTA
TGGAGGAAAACGACTGCAGAAGCGACATCACGTGCAACTCGTAATCTACTTCCCCAAGACAAGGACGATTTTCTATTAAGATTACCCTTTTTGAAAAGTA
GATCGCTAAGAGATATACCTTTAACATATTCATACACGATAACTGGCTCTTCAAACTCTAGACAGCAACCGATTAGTCTCAGCACATTCTTCAGATGACT
CATC

chr06 35,185,514 G G A
GCAAGATGCAATTACGTAGCA
GCAATCCTCGCAAAAAGGGG
21
20
21
60.11
135
CTGACTAAGTGTTACTGCTAGTTCTGAACATATACCACATAGTACACCTTATAGAGGCACATAAGTACCATTGGTTTATTACATCTTGCTAAATGAACAT
TTGGCCCCTTTAACCACAATAGGAAATGAAGAAAAATACAGCTCATTTCAACATGCTTCATAAGATTTTAAATGACACATAGTATTAAGTTCTTCCTAAA
TAAACAGATCAAATTCAAAAGATAACTGTTCAATCTTCACTATCTAGTGTCTTCCATGCTAATATAATGCAAGATGCAATTACGTAGCATAAGGATAAG[
G/A]TACGACAAAGCCAAATTTTTTCTAAGCTAATATGTATAGTCTCTAGATATGCAGGAATATAAAGCAGTGACATGCTTAAACATCCCCTTTTTGCGA
GGATTGCTTGACAATATTTTGGGTTAAGGTGAAGTCCCACTTTTATTGTGCTTCTACATTATTTTTATATATATATATATCGCTAGGATCGGAATCCTAC
AAATTTTTCTGATACTCAAATGTAAAGACCTAATGTAACACAGGATGGATTGCTCAAACTTAGTATTCATTTGATTACATAGATAAATATAAATCTGTTT
ATGA

chr06 35,701,469 G G T
CACGGAAAATAATCTCTTGTTGCA
TGACCACAATGACCTGCCAA
24
20
24
59.82
101
AGATTTGTATGAAAATAGTCTCCATTATTTAAATGTGTAACTGAATTTTTGATTTCCTTATATCCTAAAAAAGGTCATCTTCCTGTATTCTAGTCTTTAG
CCGCCTGATCTTAGATGAGAAAGTATATCACCTCCATAAGGCATACTTCTTTAATAGTAAAAGGTCATATCCTTGATAATATCAGTTATCAATTTTTGAC
AAATATATCACGGCTGATGCTAATTGCAGAGAGAGAAAAAGAAGCACGGAAAATAATCTCTTGTTGCAATATAATATAACATTTCTTCTTCATTGACAT[
G/T]GCGTTTAGAGTACATGATCAATGGTTTGGCAGGTCATTGTGGTCATAGGGGGTGCCACAAGTGCCTCTGACATCTCCAGAGAAATTGCTGAAGTTG
CTAAAGAGGTCCACATTTCTTCTAGATAAGCTCTAAGTAGGACTCCCAAAAAGGTGCATGGATATGAAAATCTATGTCTCCACTCTATTGTAAAGTTGTT
AATAACTTATGTAATTCTGTGGGGAATTGTCGATAATGCTGTATCTTCATGTTGCTAGAAATAACTTATACTGGCTAAATAATGCAGATTGAAGCTGTTG
GTAT

chr06 37,817,774 A A G
TGGATATGTTTTATAAGGCCAGTG
CCAAACAAGCACTCACCTCG
24
20
24
59.41
81
CCTGCTGCTCCTCCAGCCCCCAAAGGACTATATCTATATGGCAATGTTGGGAGTGGTACTATTGCTTCTTTTCTAATTATGTTGCATGGTTGTTCATACA
TGCTGTACAAATTCATTTCATCCTCATTTTCTATAATGATGAAAATTTTCTTTTATTAGCTTCTATTAGCGATCAGCATCAGCCATTTTCTCACAGACAT
AAACAAAATCTGACTATATATTGGACCTCATTTAGGGAAGACAATGATTATGGATATGTTTTATAAGGCCAGTGAAGGCATTGTTAAACATCGAAGAAG[
A/G]TTTCACTTTCACGAGGTGAGTGCTTGTTTGGGCCTTATATTTTAACTTGATTTATAATATTCTACACATCAATCAATTGATCAAACTAGTTGGGGT
CAGCTATAAGCCCTATATATCCATTCCAGGCTCTGAGGACCCATTTCATTCCATACTAGTCCGGTTCTACATATGCATGACAAAATCATCTCGATTTCCT
GAAACAATTTAGTCTGTCCTATCCTGAATTTCTCTTCCTCAGAGTTGTGCTTCTAAGCAAAATGTCACAGGTCAAACAATTTGCAATGCAAGATTGTCTG
CCCA

chr06 44,811,113 T T C
GGAACAGACAATCGTTTCTTGGA
AGAATTTCTGAGCTTCCTCACT
23
22
23
57.09
80
GACACGAGGATGAAACTTTGATACTATTTTTCCGGATGCTTAAGTCAAGGATGGAACCAGATGAATTCACTTATGGTAGCGTTTTAAAGGCCTGTGCAGC
TCGTCAAGATTTTAACACTGGCATGGTGATCCACAACAGGATCATAAAATCAGGGATGGGGTTGGAGTGCTTCATTGGGAGTGCTGTAATAGATATGTAC
TGTAAATGTGAAAAGGTAGAAGAGGCAGAGAAACTCCACGAGAGAATGAAGGAACAGACAATCGTTTCTTGGAATGCAATCATATCGGGGTTCTCATTG[
T/C]GTGAACAAAGTGAGGAAGCTCAGAAATTCTTCTCTAGAATGCTGGAAGAGGGAGTAAAACCTGATAACTTTACCTTTGCAACAGTTCTTGATACCT
GTGCCAATCTAGCTACTGTTGGGCTCGGAAAGCAAATTCATGCTCAAATTATAAAGCAAGAATTGCAATCAGATGTGTTTATAACTAGCACTCTTGTTGA
CATGTACTCGAAATGTGGGAACATGCAGGATTCTAGGTTGATGTTTGAAAAAGCACCAAAAAAGGATTTTGTCACATGGAATGCTCTGGTTTGTGGCTAT
GCAC

chr06 44,835,669 T T G
ATGACGCTAAGTGCCGGAAA
GCAGCAGCATTTTTAACATTCA
20
22
20
56.75
82
CTACAGGCAGCATGTGAAGAGTTGAGAAGTAGCAGAATGTTCTTGAAGCTTCTGGAAGCCGTGTTGAAGACGGGTAACCGCATGAATGTTGGGACAAACA
GGGGAGATGCTCATGCCTTCAAACTTGACACTCTGCTAAAGCTTGTAGATGTAAAGGGAGCAGATGGGAAAACAACCCTTTTGCATTTTGTGGTTCAGGA
GATTATAAAAGGTGAAGGTACTCGTCTTTCCGGAGGAAATCAGAACGAACAGTGTACCACTAATGATGACGCTAAGTGCCGGAAACTTGGCCTTCAAGT[
T/G]GTTTCCAACATTACTTCAGAGCTTATGAATGTTAAAAATGCTGCTGCTATGGATTCAGAAGTGCTCCACAGCGATGTTTTAAAGCTTTCTAAGGGG
ATTGGAAACATTGCTGAGGTTGCAGGATACATTGAAGCGGTTGGATCAGAGGAAAGCAGTACTAAAAAATTCTCCGAGTCCATGAACAGGTTTATGGAAA
TAGCAGAAGAGAAGATCATACGGCTCCAAGCTCAAGAGGCGTTGGCCATGTCACTGGTGAAGGAAATAACCGAGTATTTCCATGGAGATTCAGCTAGAGA
AGAG

chr07 1,958,146 A C A
TGCTCGACAATCACCAGCAT
TCATCTCATTACGCTAAGAGTAG
20
23
20
55.19
108
CAGCAGTTTCAGTTCAGGTTCAGCGCTCAATGGTCCGCCCTTCTCAACTTCCTTCAATCCTTTAATATGCCAGTTACCTAAAGCCCGGCTCACGCCTAGC
TGTCCATTCAAATAGCCATCATCAACAAATCCACCTACTGACTCGATGCGAGTTCTTTCAGTAACACAACAAGGTCTGTGGTCCCTTGACATTTCTATAG
CCAGTCCACGTCGAGATACAACTGCTCGACAATCACCAGCATTGGCCACAAGAAGTGATCTGTTCATATGATACAACACATCAGTAAAAAGATTTTGAT[
A/C]AAAGTGGCTACTCTTAGCGTAATGAGATGACTTAGGTACAGGAATAACTTACCTTCCAAATATCATTGCAGTGAGTGCAGTAGTGCCGGAGGACAA
GGCTGAGTCAACATAGCATGACTTGGCAAAGGCAGCATCCGTCTCTGCAAAAGATCTTGTGACCACTTTCTCAAGTTCCAGGGGAAAATCAGCATCCTCG
ACAATGATCTTTGGTAAGTAATCACGAACAAACTGTGATGCTCCTTTCCCTCCATGTCCATCAAAGACCTGTCATTAGAACCATTAGCATTAGGCATCAT
CAGA

chr07 55,930,382 T G T
ACCAGAATGGGAAGTTCGGA
GATCCCGTACATCTCCCCAG
20
20
20
59.03
89
GGTTATGCATTTAACCGGACAGTGTGGAGGAAAATTCATAATAAGGCAGCAGGATTTTGCACTTTTGATGATTACAATTGGGATATAACAATGTGGTCGA
CAGTTTATCCTTCATTTGGTTCTCCAGTTTACACATTACGTGGGTCTAGGACCAGTGCCGTTCATTTTGGGAAATGTGGTTTGCATCAAGGTCATAGTCG
TAATCTAGCTTGTATGGACAATGGCAATGTGAATATTGTTGTCGATGAACTTGATAAAGTGGCAAATATCAAACCAGAATGGGAAGTTCGGAAATATGA[
T/G]CACCAGGCAGGATATCAGGCTGGTTTCAAGGGATGGGGAGGCTGGGGAGATGTACGGGATCACGAATTGTGTGTGGAGTTTGCTAAAATGTATGTC
TGAGGGTGGTCTTGCACTTTCTGAAGAGTGATATTTTGAGCTTCACAACCATACTACTTTTAAGGTCTGGAAACCATGGAAATCACTCTTTAGTGTAAAA
CATGTGTAAAGTTTTAGGAATGACGTTATGTTTTGCATTCACAGGCCAGCTATTATTGAGTGCACACTAAATTTTGTTTTGCATCCCCTTTCTGGATAGT
GGTG

chr07 60,657,795 T C T
TGTTGTAAGTTGCTAATTGGGGA
TGAATGGATATACAGAGAATGCC
23
23
23
55.94
84
TTCCCAGTTTTAAGTAACATACTTGCAACTGTACAGTAAGCGAAGGCATCATATGTATATCCTTTCCTTCTCATCTCTGCAAAGATCTTAAGGCCTTCTT
CAAATTGTTCACATTTGAAGCAGCATTTCATTACTGTCGTATAAGTGATGGCATTGGGGATATGACCTGATTCTACCAGCTCGTTGAGAAATTCTCTTGC
AGTTTTACCCCGTCCTGACTTGCACAGTCCATGAATAAGAATGTTGTAAGTTGCTAATTGGGGAATAAATCCATGACGTTTTATACTCCTAAATAACAT[
T/C]AAGGCATTCTCTGTATATCCATTCATACAAAGACCATTAATTAATATATTGAATGTTGCTGGATGAACAGAAATATTTTTCAAAAGAATATCCTGA
AAAACCCTGTATGCTTCATCTGGCTTTCTCAATTTAAAGAAGCAATGCATTAATGTATTGTAACTCCAAATATCAGGAAGAATACTCATCTCAAGCATTT
CTTCAAACAGATCGAAACATCGAGATATCATGCAATATCTGGTAGCTCCAGCTATTAAAGAGTTATATGTAATAGTATCAGGATAAATTCCAGCCTCTTT
CATC

chr07 62,455,841 G A G
GTGGTCCTAGCCATCTTGCT
GGGTGGCAGAAGTGAAACGT
20
20
20
60.82
150
ATCTGGATGCTGCTCCTGCTGCTATTGCACGTCTTTTTTCAATTGAGTGGTACAAAAACCGCATTAATGGGAAGCAAGAAGTCATGATTGGCTACTCAGA
CTCTGGAAAGGATGCTGGTCGGCTGTCGGCAGCATGGCAGCTATATAAGGCTCAAGAGGAGCTTATAAAAGTTGCCAAACAATATGACGTGAAGCTAATT
ATGTTCCATGGCAGAGGTGGTACAGTTGGAAGAGGAGGTGGTCCTAGCCATCTTGCTATATTATCTCAGCCACCTGATACGATTCAGGGATCTCTTCGC[
G/A]TAACAGTTCAAGGTGAGGTTATTGAGCAATCATTTGGGGAGGAACACTTGTGTTTTAGGACACTCCAACGTTTCACTTCTGCCACCCTAGAACATG
GAATGTATCCACCTTTCCCCCCAAAGCCAGAATGGCGTGCACTTCTGGATGAAATTTCTGTTGTTGCTACAGAGAAGTATAGGTCAATAGTATTCAAGGA
ACCCCGATTTGTCGAGTACTTCCGCCTGGTCAGTGTGCTAGGAAAATGCAATATATTACTTATCTAACAATAGGTGTTACCAAAAGGTAACAAATATTTC
TACA

chr08 37,792,547 G A G
ACCTGATCTTTATTTGGGATTGAG
GGTGATTTACCTACTATGGTGTAT
24
24
24
55.49
80
CTTCTCTTGGTTGAGATACTGCTGTAATTTGTTGAGTTTTCGAGCTTACAACATCCTTCCTAGCTTCGCCTTTTCATAACTCACCCCTGCGTTGCATATC
CGAATTGTATTACCCATGGTTTCCCATAGGATGGTAATCTTGATATATTATATTTGATATGTTTGTGGCATTAACCTGTTGATTGTTAGAATCGATTTCA
TTTCCTTCCCCCATTAACAGCTTTCATTCGACTAGCCTTTGAGTCACCGACATTCTTGTCGCGGACAACCTGATCTTTATTTGGGATTGAGATTGTAGT[
G/A]AGAGGTATGCCTTCTCCATGGTAATACACCATAGTAGGTAAATCACCACGATTCAACTTGGAAGTTAGTCGATTTTGAGCTCGAGTTTCATGAAGG
TCCTTCGCGACTTCCCCTGAAATTGAAAACTCGATTCTCTCAAATAGCAAAGTATGTTGTTACCATTGATTAGAAGAAATATTCCCAATATTCCTATCAT
CTTGAATTAACCTTATAGATTCAGGGGAAATAATTTAGCGATTCCCTGCCATTTCACTCTCGGAACTCTCACTTTTCATCGCTTCAATCAATGCCAAATT
CCCA

chr08 54,693,944 C T C
TCAGGAGGAAATTGAGTCGTGT
CTGCTGGTTCAAAGGAATGAGT
22
22
22
58.85
87
GAGATGACCTGCCAGTCTAATGGTGAGAGTGAGAAAGTTTCATTGCCTCGTGATAGGAGTATTTTGGTGTATCCACAAACTTCAGTGAGTTACAGAGAAA
TGTGGTGTACCCACAAGCTGTACTTACAACTGGATGGATGCGCCAATGAATAGGGTCAAATGCGTGGTCCTTAAATTAATGGTTTCGTCCTCTGATACGA
ATGGACCAACAAATTTGTACACGTGAGTTACCAAATATTCAGGAGGAAATTGAGTCGTGTTTCCAACAACTTGCCCTACAGTAACTCAGGGGCTGAACA[
C/T]GGAACTCATTCCTTTGAACCAGCAGATGGCGACTGCTGGCTTTGCCGGAACACTTGCTTCAGGTACGTCTTCGGTACTTCTTCTATATTTAAATAT
TTGTGATGTTCTTTGTGATGTTCTTTTAGTTACTTGTTTCTTCAAGCTATCATGTGCAACTTTGTCTCTGCTAGAAGTGTTTCCATTGTCCAAAACCAAA
AATATAACTTCTCGCTATTCACAATTGTAACTAATGTAATTATGGAAGAGACAAACATACTTATACTGTTTTGATAAAGGACAAATAGACGTTCTTTGCA
TTTT

chr08 58,454,935 T Y T
TGCTCTGCAGGATTACATGA
TGTCCTCTTGTGATGGATCGC
20
21
20
60.13
80
AGGGAGCACAGGCTGGTTTTCCAGGAAATTATTTGAACCGGAATTCACAAGCTGGATACTCACGTTTTGGTTCAGGAAATGAATTTATGTCACAGGTAAG
CTGTCCGGCCCCTTGGCCCCTTCATTTCTTGCTCTATTAAGTTTGTGGGGGGGGGGTTTGGAAGAGGTCGCAGTCTCTTCATAGGTGGTGAACAACTGTT
ATCTAATGTGGTTTTCTTTGCTGATGTTTGTCTTCTTCCTGTTTACGTAGGTCTAATGCTTATGTAATCATTTTGATTGCTCTGCAGGATTACATGACT[
T/C]ATGGATCCCAAGGTCTCTTCACACAAGCTGGATACAGCGATCCATCACAAGAGGACAGTTCACAAAACCATTTTGGCATGTCCAATGCAAATCCAC
TTCACTCTCAGGTTACTGCATCATAATTCTGCTTGGTAGTTAACAAGATCATTGAAAGACTTCCAAATATGAAATATGCACATCACGTGAAGTCTCTAGC
TACTGGGAAGTTCATTCTTCACCAGTATCAAGATTTAGGGGACTTCCCGTGTTGCAAAATGATCTTTTTATTGGTTAGTTCACCAGTCTAATTAATGGCA
ATAT

chr08 58,808,387 C A C
GGTAACTCAAATGATGCATACAC
GTTGGCCGAACAACCTTCAC
23
20
23
59.97
92
ATGGCAATTAAAGAGGTTCAAACGCCAAAGAGAACGGAGAATACCAATAGAATCAGGTACCTTGCCAAAAATACCGGTATAAGAGAAGTCCAACTCTAAA
ACACTTTTACTGAAATTCCAGTGGAAATTTGGCAAAGTGCCTGTTAACGACGGATTATCTCCCAATCCCAGCACTTGCAAGTTTGGTAGACGAAAAAGCT
GAGAATCAGTTATGTTCCCAAACATGTTGGTGCCTTGAAGACTTAACTTCCTAAGGGAAGAAGGGAACTTCTTAGGTAACTCAAATGATGCATACACAT[
C/A]GTCAAACAACAGTACCTCTAAGTTGGTTAAGTTGTGCAGCAAACTTGTGAAGGTTGTTCGGCCAACTTGTATGTAACTTCCGGAGAGATCAAGTGA
AATCAACTTAGACAGCTTGCATAACCCTGGTGGAATCATCTTCCTTTCGTTAAATATTCCAGAATCCGAAAGATTGAGATGCGTCAAGCTACTGAGTTCA
CTAATACTATTTCCAAGTGGGAAGTCATTGAACACATTGAGGGCAAGGTTGAGTCTTTGGAGATGACCAAGTTTTGTGAGGCTATTGTTAGCATTGATGG
TTCC

chr09 2,095,130 C C T
AGAACACTTACCACCCCCAA
AGAGAAGCTTAGTACCTCAGAGA
20
23
20
57.56
105
CAATTAACCTTTCGAAGGAGGGAAATGCAGAATTTCTTCTAGGAGATCATACTATAATTCCAAGAGTACAGAAAACATGTCCTGGTTTGGTTATCAAAAA
AAGAAAACATGCCCGGGTTAGGACTTACGACTTACCAAGAGTCTACTTTCTGCAATTTCAGGCATAGTAGTATTTGTTAGGTGTAATAGTCAATTCACTA
TAGTCTTTGAACAATATATCAGGATACAAAAAAGAAGTTATGAGAAAAGAACACTTACCACCCCCAAATCAAGATCAAGTGCTGACATGTATGATTGGA[
C/T]AGTTGCAGCATGATTCTTAAAATATTCTTTCTCTGAGGTACTAAGCTTCTCTTCAATTTCTTCTGGGAGGACACGCTCAAGGGTCCATCCCAATCT
TCGAACAACTTCTGCACGATTGTATCTAAAGAAGGAACAACAAAGAAAGTCGACAACAAACATAAGAGATGCAGGAAGATCAGGAATATATGACCGTTTC
CCAAGGACAACTCTGAAGCCAAGTGTTACTCACACATAAGCCATCAGACAGCGCTTGTTGCGAGTGAGAGACTGATGATGGATAAGCAGCCCGTGGTAAT
TATC

chr09 2,209,419 A A G
TCCTGCTACTTTGGCACTTACA
AGACTCAACCTCACCATTCA
22
20
22
56.08
85
TTGTTGAATATGGTTGTTTCTTCTTTTTAATGTGCCAACAAATAACTTCTCCGTTAAACATTCCGTGCTATGCACCTAATTTAACCCTTTCTTTTGGACA
TGTTTACAGAATGATCTAGTGGCTTGTACGCCATTGTACTGGGTGCTCAACTTATTACAGGTACGTTTACATCTTTCATATCAAACACTACTTTTTATTA
ACTCTATTCTCTCAAGTATTCGCTATGATCATTATGTGTGCAAGCGTTTTTGCCTTTTTTATGTATTTATGAATATCCTGCTACTTTGGCACTTACAAA[
A/G]TCCTGTTGTGTATTTGAGTCATATCGGTAGGCATTATCTTTGAATGGTGAGGTTGAGTCTTATTGAATGCATTTGTGTTTTCAGTTTCCAGTAGCA
CTGGGGGTGTTCGGATATGAATGTGTGAAATTGTACAAGGAGAGCAAGAAGAGGAGATTAGAAGGGAACCAAGAGTCAGTATGTGAGGCTGACATTCAAT
GGACCGCCACAAACCTTATATTTTGTGCGCTTTGTGGTATATTGGGAGGCACTGTTGGAGGATTGCTCGGATCTGGTGGTGGATTCATTCTTGGCCCTCT
TCTT

chr09 2,417,881 A A G
CTATTCAGCCACCGGGAAGA
TGCATGTGCTTCACGTATGC
20
20
20
59.55
101
ATTAATGTAATATAGCACATAAGAGAGGAGCCCTTTTGAAAACAATGCAAAGTAACCGGTTCCTATCTGTAAGCTGATTAATTAGAGAACTCATGATTGT
AAGGAACACTTCTGCATAGCTAAGCTGGACTGAGCAAGTCCCAGGTTCCAATCTCAGTAGTAGTTGCACTGCAGTAGTAGAGGGTAATTGCGCTAAATAG
GTCAAGCTTTTCATCAGTCTCTCTATAGATTAATACTCCCTTATGTACCAAACCCGTATCAGGTGAAACTTCGGATTCTATTCAGCCACCGGGAAGACA[
A/G]TGCAACTCCCAAGAAACTGGTAGACTATGTGATGATGAAACATGTTTTGCATGCAACAGCATACGTGAAGCACATGCACAAACTGTGAGAGGGACA
ATTCTGGTAAGAGAAGAGAACAAACTGTTTTAGTGTATGTCATGGGAAAGTGATACGATAATCCTGATCATCTCTGAATATACTTTCTAACAGATACCAT
GTAGAACAGCTATGAGAGGTAGCTTTCCGCTCAATGGTACATACTTCCAGGTTAACGAGGTGAATACAACCAACGTTTCCTCAACTCGAGCGAGCATTTT
TTGC

chr09 61,087,379 T G T
GATGCTTCTCTGCTGGCAAC
AGTTCTTGAAGTTGTGGTTGT
20
21
20
55.85
81
GATAATGTTGGATATCTCTCTTTTCAGCTGAAAGAAGCATATTGTGGTAGGATTATTGTAATTATTTATGTCGAAAACAATTTCTTAATGTTATGATACT
TTACAGGTTATGAAGCACCAAATCTGAGGTATGTACTGATTCTCAAGTTCAGCTTGGAGTTGTCTAATAGTACCTTCTAAAATTACTTTTTCTTTCCACT
TCACAATTTGTTATTTTTTTCATATATTTCTGTACTAATGTTTGCACCATACGTATACTCTTGGATGCTTCTCTGCTGGCAACAACTGCGTTTCTTGCT[
T/G]TCATGGATATGACAGTATCATATACAACCACAACTTCAAGAACTAACAATAACGTTATGGCTTGTATGAGTCCACCTCAAGTCCCTTGACAAAACT
AGTACAAAAGTATTAAGATGAATGCTCAAAGTAAATGACTCAAATGTTTACGTGGAAACCTCCTTGCTCGAGGGAAAGAAAACCTGTTACACAAGATTTC
TCAAAGCTCCAAAATCTTTAAGCAACTTGTAAATACAAACTCGAGTTACCTCTCCTATGTGGTTTGTGAGCAATTGCATAGGAATAGAGGTTTTTACCCA
GTGC

chr09 63,185,282 C T C
TTCACAGATAACGAAGAGGATGA
AAGATGCCATCGTCTTCTCTCC
23
22
23
59.9
80
ACAGTATCTCACAGACTATCTGCGAGGGAGCTTCTCGATGACCCTTTTCTCCAAGTTGATGATTACGTGTCAGACTCAGAGACACCAAATTATTTGCAAG
ACTCTAATGAATTTGACGTTACCTTAGGGCATCGACCCTCGAGCATATGTGATAACAACTCTCTAGTAAATGGATGTCTTGGTTATCTTGGATATGAACC
AGAGGATGATTCGTACTACCATCAACTTGAGTATGAGGCAAATGAAATTGATTTATTCACAGATAACGAAGAGGATGATATGGAAAATGCTGATATCAG[
C/T]ATCAAGGGAAGGAGGAGAGAAGACGATGGCATCTTTTTACGACTCAGGATAGCAGATAAAGAAGGTTTTGCTTTATTATTGCTTCATATATATCAA
GTAGTGTTCAGTAGTCTTGCTGTTAACTAAATTGCTGTGCATTTACATTCACAGGCCGTATCCGCAACATTTATTTTCCTTTTGACATTGAGAATGACAC
AGCACTAACTGTCGCTACTGAAATGGTGGCCGAGTTGGATATTACAGAACAAGATGTTACCAAGATAGCAGACATGATAGATGGTGAGATTGCTTCCTTA
GTGC

chr09 63,455,142 G A G
ACACGTTCGTGCAATCGTTG
TGGCAAATCAAGGGAGCAAGA
20
21
20
60.2
99
TACGCGAACACATTAAGGCTATTAACAAGAAGATTGATTTTCATTTCTTACCATTGCATTGGCTAAGAGGTGGAGTTTGAACATTACAAGCAGTAGGAAG
TGCCAAGGCCTGAGTTTGGTTAATATTTAGCCCCAAATTAGAAGCACCACCATTTAGGACTTGACACAAACAACTTGGATTGTTGTTAACCACAGTGGCA
AGTTGAGTGCAACAACCTGAAGTTGGAACAGAGGAATTGCCAGTAATATAGTTCAAGCAAGGTGACATACTAATCAACACGTTCGTGCAATCGTTGCTC[
G/A]ATTGAGCAACAACTCCAGAACAGATCATCGCAAACATAATCGCGAAAAAACTCATCTTGCTCCCTTGATTTGCCATTTGATATGATTAGATTTTTA
TTTTTTTTAATTGATGTTTGATCACACAAATGTTGTTTGAATAAGAAATGTTGTGTTTGTTTATATAGGAAAAAAGTTGAGTAGGGAGAGTCAAAAGAAG
ATGTTTTTTTTAAAAATTGGTGACCGATAAACAAATAGTAACAATTTGACATTATTTTGTTTTATTATATAGTTTACACAGGAATTAGGTAGATTTGGGA
CAAA

chr10 4,634,227 C C T
TGCACTTTCTTGGACAAAACA
TGACCAAAGTTTCCCGGCTT
21
20
21
60.11
134
TTCCTAAATGGAGACATGAGAAATGTGAAAGTGACTCGAAATGGTTGGGTACTCAAATATGGCCTCTAGACAAACAAGAACAGAAAAGAATGTTAATTGA
AAGAGATCCTATTGGAAAAGGAAGGCAAGATACATGTGGCTGCCAATACCCTGCTTCTTATGAATGCATCAGGTTTCATCTCGCTGAGAAACGAAGGAAG
GTTAAACTTGAGTTGGGATCAGCCTTTTGTCGGTGGAAATTTGATTTGATGGGCGAAGACGTTGCACTTTCTTGGACAAAACAAGAAGAACAGAAATTC[
C/T]AGGATATAGTAAAAATGAACCCTTTGTCGACAGACAAGAGTTTTTGGAATGAGATATTCAAATTCTTTCCTAACAAAAGCCGGGAAACTTTGGTCA
GCTACCACTTCAATGTCTTCCTTTTACGGTGTAGAGGTCATCAGAACCGGACTGCTGCAAGTACTATCGACAGTGATGATGATGAACCACAGTACGGACC
TAGAACTAATTGTTTCGGTAGGGATCCTCAATTCTCCATCTTTTGTTCCCCGAGGAAAGCACATCTGGATCCCAGATAGTAGTTGAATGTTTATATTCCA
CGAC

chr10 60,090,996 A G A
CCTCTTTTCCGACCACCCTC
CTGTGAATAGTATCGATGGAGTCA
20
24
20
57.68
114
TTAGCTTGCCGCTAACAGCAAAGATGATTGATGCTTTCTTGCTCGTCTGAACTGCATTGTCTTCTTAATTTTGGGCTCAGAGCACGGGCCAACAGCAAAG
TATACATAACTGAGTGTGTTTATTTTCAAGTGAATATCAATCTGCAGCCTCTCGCAAGATCTGAAAAGCCACAGTCGAACAGCACAGAAACACATACAGT
TGTTGATGGCAATGATCGCCAGGAGAAGCAAGAGCTCTGTACATCTCTTGCATGAAGTCCTCTTTTCCGACCACCCTCTTCCCTGCTCATACACCCAGC[
A/G]GCAGACCTATGTAGATGTGTACATGAAATGGAAGAAAGACTCTTTTTTTGACTCCATCGATACTATTCACAGATCAGTTCAACTCAAGCCCTTAAT
TGCTCTTAAGAACTGCATAGTCTCCTCTTCACCTAATGATTATTGCATCCCCATTTCTGTTATTTCGAAAAAAGGCTTAGAGTTAGGGATACCCATTAAG
GTTGCCAGGTTCTTAAGGCTGTATCCATCTGTTTTTGAGGAATTTACTGGCCCTAACTACAATTTGCCTTGGTTTAAGTTGACCCAGAGGGCTATTGAGC
TTGA

chr10 62,499,936 C T C
CCCAAGGCTAGAAGATGTACCA
GGAACAGATGCCTTTCAGGGA
22
21
22
60
90
TTTTGTTTGGATTTGGTCAAAGAAAAACAAGGAGATATATTGAGCTGTAGCAGAAAACTTTATTTAACCAAATGGAAGACAATGCTATATACAGTGAAGA
ATAGTAAAGAATCATTACTTGGTAATTCAAGAGTAAGACAAGACTGGAGCCACTGAACGCGACATCAGATTCCCTCTAGGTACGCGATATATACTTTCAT
TCATCCATCATGCCTATAAATCTTACCATAAGACTTACGCGCTGATAACCAAATATTCATACCCAAGGCTAGAAGATGTACCATCATCACCATCAAGCT[
C/T]CCAACATGCACCCTTCAACAAGAATGTCTTTCCCTGAAAGGCATCTGTTCCTACAAGGTGGGAATGCCAATGGAGACTCAGGGCTTGTTCTTTCAA
CGGATGCTAAACCAAGATTGAAATGGACACCAGACCTCCATGAGAGGTTTATAGAAGCAGTTACACAACTTGGTGGGGCAGACAGTAAGTGCACATAAAT
ATGTTAATTTGAATAAGCACCAGATGTATGTTGCTTATGACTGAGATATTAAATATCCACCATTCTTCTATTGCAGAAGCCACACCAAAATCAGTTCTGA
AACT

chr11 4,155,877 C T C
ACATCAATGAAACAAAGAACTGGG
GGTTGAGTTAGACCCAATGTCCA
24
23
24
60.24
80
TTCCTTTTTCACAGCGGCATCAACTGAAGACCTGCACATGTTACCACCAATATTAAATGCAAAATATACGCCACTTTTTTCAGAAAATTTTGTAAGGATT
GATAAAGAAATGAATATTGGGTCAAACTCAACCCTAAAAATTAGTTCATTGCCAAGCCATATAAAGAGATCAATTCCCCAATCCCTAGGCCAATGTGGGA
GACTCGACAACCCCACCTGCCAACCAGAGCATGAACAATACAAATGGGGGCCCAACATCAATGAAACAAAGAACTGGGATGGGTTCGACACTAATATCA[
C/T]GATAAAGAAAATGGACATTGGGTCTAACTCAACCCCAAAAGCTAACTCAAGAGATGAGAATTGCTCACTCCATATTAAGAGAGCAAGTCCCCCGCC
TCTTAGCCGATGCGGGAGACTCAACAAGGATGACTAAATCGAAAGACTTTCTGTGGAAAAAGTTTTGAAACATTTTCCCAACTAATGAAGAAAAGAAACA
AGAGGACTAATGAAGAAAAGAAGCAAGAGGTACCACCAAGCTATAACCACCAAAGCAATTGTGGCAAAAACTAAAAATTATACAATAATCTAAATTGATG
TATA

chr11 4,256,244 C T C
AGCCTCATTCTTTACACTGAAACT
AGCTAGACTACTCATCTGCTGTG
24
23
24
59.37
86
GCAAATAACTCAACCCAAAATCAATATTGCATTTTATCCTTTCTTACTCAAGTTAATTAAGTATCTGGTGCTTGTTTTTCCATAAATACACTCGATATCT
TATTGTCAAGGGAAGCACATTTTGTCGTAAATTTAACAGGAGAGATGATGACATTACCGTAGTCCATTTGATAGTTGTTCAGGTACAGTATATGAGTGGT
GGTGAAGGCAAGCAATGGAGCAGCAACCAGAACTCTCGTAGCCTCATTCTTTACACTGAAACTTCTTAGTACTGATACAATCAGGGAAAATCCAAGTAA[
C/T]GCCACAGCAGATGAGTAGTCTAGCTTTTCTGTAAAATCCATGTCTCTACAATAAATAAACAAAAAATAATTTAATTGGTATGCTGAACTAATATTG
CAAGAAAAGATAAACGTCAAGCCAGATAGGCAGGCACTGCCAACAAATTCTAACTGCATACAATTATAAAGAAAAGCCCAAACTATATATTGGTAAGTTA
GGAAATCAAAATCAGCATTACCAAGACTGCCAAATCATAAACTTACCGACCGTGGAAGATAGCACTCCATAACCATGAATTAATAGACAAGAACGCATAG
ATGT

chr11 7,830,934 T G T
TGAATGCCATCCTTGTTCTTGT
TCCTCTCTGTGAAGAGGGTCT
22
21
22
59.29
126
TACATGTCCGTAGTCGACCTAGTGTACGCCACAAGTACACCTTTAGCCTCTAGACACCTCCATAGAACCTCCTTGAGGACTGTGTCATAAGGCTTTTCTA
GATTGATGCAATACCATATGTACGTCTTACTTCCTCTACCTATACTGCGTCACCTGTTTCTTTACTAGATGAATGGCTTTTGCAGTCTAGCGCCATGACA
TATATCCGAAATGGTTCACAAAAATAGCCATGATCCTCCCTCATCTGCACCAGTTGCAATTTTGAATGCCATCCTTGTTCTTGTACAATGGCATAATCG[
T/G]ACTTCATCTCCATGTTTTGGGCATCTACACCGTCTTGAAAACGACATTATACAACTCAGTCGTTTCTAGACCCTCTTCACAGAGAGGAAATATCTT
CTTGTCCTTTCTAGACCCTCTTGACAATTTTAGAACCGTATTGGCATGCATTATTCTTCCATTTTAAAAGTGAAGCTTCCTTCCGGAATTAACAGTCTAT
AGAGAATGACAGACTAAACACTTGTGATTTGCTTCGAGTTCGGAGAAATAAATGTTATTTCTCCTAACTAGTGTGTAATGTTTAAACTACTAGACATAGC
AATG

chr11 14,406,213 T T C
CCAGATCATCATCTTCACGAGC
TGGTTATTTTCCTCACTGGCT
22
21
22
57.19
93
TACCCTATGTATAACATTCCAATAATAGCAAATATGATCACAAGGAGAACAAGTGTTGTAAGCTGAGCACCAGTGCCAACAACAGCTGAAAGAAGGGCCA
AATTTTGTGGAGGTCGGAAAACATCACCATGGACAAGTTTCCAACCAGACTCTTCATTCACATCCCTCTCCTGTACAATTGTTTATTTATAAACCATAAA
AAATATGTAACTGACGAATACATGATTCATTGAGAAAAAAAAAAGATTACCAGACTCTCCAGATCATCATCTTCACGAGCATATTTAGCATAATCATTA[
T/C]GAAGAGTGCGCATCAAAATCATAGACACTAAGCCAGTGAGGAAAATAACCATCATGAAAGAATTGAACACCGAGAACCAGTGGATCTGCATAAAGA
ATAAGATGTTAACAGAGGCTGGCAACAGAAAGAGAAACTCATAATTACTTGTTTTTATATGCAGCTTTCTCTTTGACTCATTGGTTTCAACAAGGAACAG
AAGAACATGAAGTTTCAAAACATATGTGACAAGTAAGCTCAAAAGGACGCTATCCAAGCAGTTGAATTCTAAACTTTTTTGGGGGCAACAAGGTATTGTC
TCTA

chr11 19,646,636 A A G
AGGCATAGCTTGTTGTTCCT
TTCAGGAGATGGGTTGCTCC
20
20
20
59.38
95
AGGAGTGATTAGTAGTGCCCATTTTTCGCAATTTACGTTCGTATGCCATTATGATTCTCTCATAATGATTAATGATAACTTGATCAGTCGTTGACACAAT
GACACACCTTGCACTTAAGCAAGTGTGTACGTGTCAAGGTATAACTGATATTTCTTCCTTCCCCTACAGTGATGGATTGTTAGATTGTAATTTTTTTCCC
TAATTGATGCTTCTCATAGTATTTTTATGAATACATTAGATTTAATAGCATCTTGATTAGGCATAGCTTGTTGTTCCTTTCTCTAATGTGGATTATACT[
A/G]AAGGGAAGGGCCCAGAAGAAGATAACTTAAAAGGGAGCAACCCATCTCCTGAAAACGATAGCTCAAAAAATACTGGATCTCCGAAAGCTCATCAGA
AGCCCTTGGACTGGAGGGAATTCCGAGCATCTCTTTACATTCAGGAGCTGGTATGGTTTATGGATTACTTCCGCAAGTGTGTAAATCATCTTATAATCTG
ATAAGTCACCTCACTTTCCTTTTCACATGATGATATTACATGTTGATAATCATTTCTTAATGTGTGTCAATGACATGATTCACCATGTCTTTTTTTTGAG
GTGT

chr11 27,448,927 T T G
GGATACCAGTTAAAACCTCAGTGA
CCAACACAGACTTTGCCTTT
24
20
24
56.74
81
TGGTTCATCTTGGGTAGCGTCCTACTAGTCAAGTGTTGGGAGCCAAATTTTGCACTAAAGGAATCAACAATCACTCACTCCCCAATCTGGGTTAGGCTAC
ATCAATTGCCCACTAAACTTTAGGACAAGAGCATCCTAGGAAAAATAGGAAAAAAACATGGGGCTCTCCTTAAAATCGATGTCTGCACATTTGCCACTCT
AAGAGGACCGTATGTAAAAATATGCATAGAGGTGTCGATAGGGATACCAGTTAAAACCTCAGTGATGATAAAGGGCCATAATCAAGATGTTCTCTATGA[
T/G]GCAAAGGCAAAGTCTGTGTTGGCTGTGGAAGAATTGGGCACATCATCACTACATGCACCAACTCAAAGACGCTCCACAGTAGGACACGAACACAAA
GTGAGAACATTAATAGCGCACCAAAGGCGAGGTTTGGAAGATTGTGGTCTTCCCTAAGAGGAAAGGGATACGACCACCAAAACTGACGGCACAACACAAG
CAATCGGCCTAGAACGTACAACCAAAACCCAAGTAATAGTTCAAATAGAGCTGAAAGGTAAGTCCCCTATCTCAAAAATTCCCCACTCACCCCCCTTCAC
TAAC

chr11 28,001,043 A A C
ACTAATCAACCAGGCAGCCT
TTTGTTGCATTGTTCATATGACT
20
23
20
55.4
84
ACTCTAACATATTGTGCCTCCCTCGTCATTTTTCACTATTACATAGTTCACAAGAATTCTCTTCTCTTTTTTTTCCGAAGATGGCAAAGCTCATCCCCAC
CAAACCTCCTTTATGAGGAGCTAAACGACACCTTTTACTTTCATCAACTCGAACACAACCTCATACTAAGCTATCACTCTATTATAAATGTCAAAAATCA
TTTTCTATAATTTAATGAAAATGGCATTTTTGCAAACTACGACAGCTCAACTAATCAACCAGGCAGCCTGTTATAGGCTTATAGCCCACACAAACAGAG[
A/C]GACCAGTTATAGTCATATGAACAATGCAACAAATTTATTCATTCAAAAGTCCCCAATTCCTCCATTCTTTCTATAATCAAAACAAAAGTATAACAC
AGCACACATGAAGCAACATCTCATAAATACTGATAACTCAATCCGACAACAACTAACCCTCTGTCCCAAACAAGCCAGGATCGACTATACGATCCTTTGT
TACTCCGTTTCAACTACAAAATACCAATATTTTTATTTGTATTATTTACCAAAACCAAAAAAAAAAACAATTACCTCAACGCCATATCTGATTGCTACAC
CAGG

chr11 28,585,137 G G A
TCTGCAGTTAATAAATGCAGCCT
GATTGTGGTGCATCTGCCAG
23
20
23
59.55
95
CAGGGAACACTTAGGGAATGGGTAACTAGAGATGAAGTCCGGCGCTTCATTGCGAAGAAATTCAAGGAATTCTTACTCACATATGTAAATCCCAAAAATG
AACATGGGGACTTTGAATATCTTCGACAGATTAATGAGATGGTATCAGGTAAATACGTTTCTGAACTTGTCAAGTCATCGCTGACCTTTTCAAGAATGAA
TTAAGTTTTATGAGTTCCAACAGAGATCTTTTATTAATTTAGATCTTCTGTTCATCATTCATCTGCAGTTAATAAATGCAGCCTTGAGATTGATTACAA[
G/A]CAATTCATATATGTCCATCCCAATATTGCCATCTGGCTGGCAGATGCACCACAATCCGTTCTTGAAGTGATGGAAGAAGTTGCCAACAAAGTTGTC
TTTGATCTTCATCCCAACTATAAGCAAATTCATCAGAAAGTCTATGTCAGGATTACCAACTTACCAGTTTATGATCAGATTCGTAATATAAGGTAATATC
ACTTGCTTACTTTGGCTTGACTACAGCTAGTGTAAATGAAACCTCACTTGAAGTTGTCATTCTTTGCAGGCAGATCCATTTGAACACCATGATTCGTATT
GGTG

chr11 34,548,178 G G T
AGTCTGACCTGGTGGACTGT
GTTGAGCAGAGAGTTTTACCT
20
21
20
55.55
129
GACTTTAGTCAAAGGTTTGAAAGCTGGCAGTTGATCATATTCTGATTCATCTTCAGAATCTCAAGACTCATCCAGATCATCATCTAAAGTCTCATTGTCA
TCACTAAATTGGTCTGCTGATAGCTTAACCTGTGGTCTTGACTGGAGAAGGGATGAAAGCTGGAAAGGTAAAGGAGGTGATCTTGATCAAGTGGCATAAG
TCTGACCTGGTGGACTGTCTCGTAACTCCAGCAATGTGCTTGTCTCAGCCAAAATTTTGGATGCAAATGACAGAAGCAACAAGTGAGGCTTCCAAACTT[
G/T]ACCATTAGGTAAAACTCTCTGCTCAACCCTGTTTGTTCTGCATTTTGAGTGATTCTCGACCAGAAAAACAGGATTCATAAGGCACACATCTCCTGC
TGCCTGCCATATTGCTTACTGAACAACATGAGACGGCTGAGTTACAAACATGTCATAACTTGTTGTAGTACCATTGGAGATTTCAGGAGGAGCAGATGCA
GCTTGAGTAAGAACAACTATTGTATTGAACCATATTGATGAGCCAAGAACTTCAGTAATTGTCCGCAACAATGTCAAGTCACCATAATCTCTACTTTGCA
TATC

chr11 36,245,209 A A G
CGCAGTGCCTATGCCTATGA
CTCAATGGAGTGGGTTGTTTCAC
20
23
20
60
80
GAAAGACAAAGAATTGGGTTGTGGCCCTTAAGTCAATAATGTTGATCCATAGATTGCTATCCGATGGCGATCCATCCTATGAGCAGGAGATTTTTTTTGC
CACGAGACGAGGAACAAGGCTTCTTAACATGTCTGAGTTTCGAGATACCAGATCTAATTCATGGGACTACTCTGCACTTGTTCGTACCTATTCTTTGTAC
CTTGATGAACAACTTGAGTATAGGATGCAGAGTCGGCGTGGAAAGCGCAGTGCCTATGCCTATGATGAAGATTTAGACAATGTTGATCCTGAAACTGTC[
A/G]CGGTGAAACAACCCACTCCATTGAGCGAAATGAAAAATGAGCACATTTTCTCAAGGATGCAATATCTCGTCCAACTTCTTGACCGATTTTTAGCTT
GTAGACCTGCAGGTTTGCATTCTACTTTAATAATTTTTAAACTATTTAGTGAAATATGTTAAATAGATTGTAATTTTTGTTTGTCATTCTGTAAGAGCAG
GTTTGGCAAGGAACAACAGAACTGTATTTGTGGCACTATATCCACTTGTGAATGAAAGTTTCCAGATATATTATCAAATAAAAGAAATAATAAGTGCCTT
GATT

chr11 36,880,642 C C A
GAAAGGCAGGGTAAGGCTGT
GCATGGTAGACTAAGCTCCCA
20
21
20
59.24
89
GAAACCTCATTAGCTGAGGGATTAATCAAGCTTTGTTTTATCTCAATTTCTCTTTCATAGCATCCATGCAGATGAAGCGATAAATAGGGCAAGTTGGAGC
ATAAAGATCCAAATAGGCGATGATGATACAATTTAGTTAGGATTATGTTTAGCCATGTTAATATATTTATCTTAGAGTTAGGCGATGAAGGGGAGTCTTG
GTGTAACTGGTAAAGTTGTTGCCATGTGACCAAAAGGTCACCGTTCGTCCTGTGGAAACAGTCTCTAGAAGAAAGGCAGGGTAAGGCTGTGTACAATAG[
C/A]CTCTTGTGGTCCGGCCCTTCCCCATACCCCTCGTATAGTGGGAGCTTAGTCTACCATGCGTCCTTCTTAGTATATTTAGTTTACACCCAATGCCTT
CTACAAATCTTTTAGGACTGTCAATGATTTATATTCCAATAGTAAATATAGAGAACTTTGTGTGCCTTCTATTTATATTTTATATTGGATTAAGATGACC
TTAAAATATGGACAATGAGAATTTATATAGCCTATCTCAACTTATTTGGAGTCAAGACATATTTGTTGTTGTTGTAGTGTGTGTGTGTGTGTGTGTGTAT
ATAA

chr11 43,360,731 T T C
TGTGCACTCATTACGACTGAGT
GCATGTGCGCTTTAGGGAAG
22
20
22
59.9
85
AAAGCTTGATAAACACTCAATAACATGCACAACTACAATTGATGCAACAAGTTCACACCCGACGTAGACTGAGTAACATGCTTAGCCCACAACTGATGTG
ACAGTCCATGACCGATCCGACAGTCTACAATTTATATCATCTAGCAGATATTTCTTGTCGTTGGCCAATGTGTCTTGACCGAAGCATATAGTCCTTAGAA
GAAGGTGTTTGCCGTTGGCATATGCTAATGTTACCTTGCTTATGTGCACTCATTACGACTGAGTCGTGCAATCTTAGGATGTTGCTTCATACCACTGCC[
T/C]AGCATCGCTTCCCTAAAGCGCACATGCCTTTGATGACGCTTCATGACATTGGCCAATGCAAATGTAGCCCTGTTGATGGACACACTCCATGTTTGA
TGCATGCAAGTCTTTTCTAGTAATGTGAGATGTGTACACACATTGATTGCTGCTTCTTGTCGTTTGTCTACATTTTTTTCCTAAAGACAAAAAGTCTTGG
TTTGTGGTGCCAACATTTCGCAGAAGACGATATCACTCAAGCGATGCACACATGCCACAGGCTATACATCTATTCCTTTGATGATGTTGCATGACATTTT
ACTA

chr12 25,090,414 G A G
GTATTGAGGATGATGATTTGCTCA
CCACCTCAAAAGATTAATAGTACG
24
24
24
55.38
80
CGATATGCTTAAAATCAGATGGAAGGAGTTGTATCCTTACATCACTCAGATTGTGCTTCTTGAGTCAAACTCAACATTTACGGGTTTGGCTAAACTCCAC
AATTTTGCACTTAATAGGGACCAATTTAAGTTCATTGAGCCTCGCTTGGCATATGGAAACATTGCCGGAAGAGATAAAAAAGGTGAAAATCCATTTGTTG
AAGAGGCATATCAGAGAGTAGCATTGGACCAACTTCTGAAACTTGCTGGTATTGAGGATGATGATTTGCTCATTATGTCCGACGTAGATGAGATTCCTA[
G/A]CGCTCGTACTATTAATCTTTTGAGGTGGTGCGATGACATTCCTCATGTCCTTCACCTTCATCTGAAGAATTACCTGTACTCATTTGAATTTCAGAT
TAAGCACAGAAGCTGGAGAGCTTCAGTCCACAGGTATCAGAGTGGTAAGACTAGATATGCACACTATCGTCAGAGTGATTACATTTTGGCGGATGCAGGT
TGGCATTGTAGCTTTTGTTTCCGCCACATTAGTGATTTTATATTCAAGATGAAAGCTTACAGCCACAGTGATAGAGTGAGGTTTTCACATTATCTGAACC
CTAC

chr12 35,201,546 C A C
ATGGGCTGACCTTCCTGTTG
GTACTCAGGCTGCCCGATTT
20
20
20
60.11
98
CAGCTTTATTGAGACAACCAGCCCGGTACTCCACTGTAAAATCATAATCCATGAGTTTACTCAACCAATGTTGTTGAGGTGGTGTAGTCAGCCATTGTTC
TAGCAATTATTTCAGGCTGTACTGATCTGTTCTGATAAGGAAAGGGCGCTCCCACAAGTATGGCCGCCAATGTTGTACTGCCTTTGCAAGGCCAATCAAC
TCCCTCTCATATGCAGCTAATTTTTGGTGACGAGCCGCTAGCTGTCGGCTAAAAAATGCTATGGGCTGACCTTCCTGTTGCATAACAGCCCCTATACCA[
C/A]CTCCTGAAGCATCACATTCTACAGTGAAATTCATAGTAAAATCGGGCAGCCTGAGTACTGGAGCAGAGGATAAGGCTTGCTGAAGCTTCTGGAATG
CATCAAGGGTCAGATCGCTCCATTGGAAGGAGTTTTTCTTAAGTAGACCAGTCAGAGGTGCTGCCAGTTGCCCATAGTCACGAATAAATTTGCGGTAGTA
ACCTGTCAATAACAAGAACCCACGAAGAGGTATAATTGATTGAGGTTGCGACTAATCCAGAATAACTTGTACTTTGCTCCTCTCTACTTCCACACCTGTA
ACTG

chr12 47,221,804 A G A
CTTGCTTGGATTGTTTCCTGGG
AGTAAGAAAAACTGAAGGGCT
22
21
22
55.03
80
CTGATCAGTAGCTGGTGTCACTTGACAAAGTATTTATGAATGTATGAAATTCATGAACAGGAATCTATGTTGGTGGAAGCAAAGTTGTTCATTTTACGCG
TGACCAAAGTATTGTTTCAGGGGACCAAATTCTCTTCTCTGCTCCCTTAAATTGCTCTTCAGCTTCGAGTACAAACGTGTCTTCAACCTGTACGAATATT
CCTGACTGTGGATTTCAACAAAAGGCAAGTGGTGTGGTTCTCTCTTGCTTGGATTGTTTCCTGGGTGAGGAGGGGCTATTGTACCGCTTTGACTATGGA[
A/G]CCAGCCCTTCAGTTTTTCTTACTAAACTTCGAGGTGGGACATGCACCACTGCACAATCTGATCCTCCAGAGGCAGTGATCCATAGAGCCATGTACT
TGCTTCAAAATGGTTTTGGAAATTATGATGTCTTCAAGAACAACTGTGAAGATTTTGCCTTGTACTGCAAAACAGGTCTTCTTGTTCTTGACCAAGGAGC
TCTTGGAAGGAGCGGTCAAGCTGCCTCTGTCATAGGTGCTCCTTTGGCAGCTATTGCCTCGTCGCCTCTGAAGTTATTCATGACAAGTCCAGCTGGCTTA
GTCG

chr12 63,101,436 T C T
CACCTACGACATCTGCCCAC
TGCATGTTTTCATTGGTAAACA
20
22
20
55.36
91
GACGCGTTGTCACTGTGAAGATGTTGGAGGAGACTTACGATGGTGTTCATGCCAAATTGCACATACATCACGACTATACCAACATACTTACTATCTCTCT
CCAGTATCGGTGAGAAGAAATCATCTAGTTGGAGGGGACTCATCGTCTGGAGGCACAGATGACCCAAAATCAATGTTTGGATACACACCAGGAGGTTGTT
CTCGAGGTTGTATAGAGAATAATTGACTTGAATCACCTACGACATCTGCCCACCCGTAGTGAGGCTCAGCCCTTCAATCATAAGTAAGACGTTTTACTT[
T/C]GATGTTTACCAATGAAAACATGCAAACATAGATGACATTCACTTACTCGTAGTACGTTTTTTCATCCACAACCATGTCCCAGCTTTCACCAGTTGT
GCTCTTGCCATATTTGTGTACCTTGCTGATTGAGGAACAAAGGGGCATACCATGAGTCTTTTTTATATTATCATTTGGGTTTCAAAGAGGAAAACTTAGC
GAGGAAATCAATATGCAACTTGCAAAATATCATAGAACGCGATGAAACATTGAATGTATAGTCATAAAATTACCCATTTCCAAAGTGCTCCTCTCCCCAT
GTCC

chr12 63,143,568 A C A
ACGATTCGTGCATTGAAACCA
GCAAACTCTCAGGAAGGAACG
21
21
21
59.2
91
CTGTTGTCCATGAACGTGGAAGCCCCGAGTCTATCAGGGACATTCGTGGTTTTGCTGTCAAGTTCTACACCAGAGAGGTAATTTCGTGTTAATTACTTGA
ACATGAACTTAGGTCACGGAATCTTTGATTGGGTTTTTTGTTTAAAATGTAATGTTTTGAATTGATTGACTCAGGGTAACTTTGATCTTGTTGGAAACAA
TGTCCCCGTGTTCTTTAATCGTGATGCTAAGTCGTTCCCTGACACGATTCGTGCATTGAAACCAAATCCAAAGTCACACATTCAGGAGAACTGGAGGAT[
A/C]CTTGATTTCTTCTCGTTCCTTCCTGAGAGTTTGCATACATTCGCCTTCTTCTACGATGATGTTTGTCTCCCAACGGATTACAGACACATGGAAGGT
TTTGGCGTTCACGCGTATCAATTGATTAACAAAGAGGGGAAAGCACATTATGTGAAGTTCCACTGGAAGCCAACTTGTGGTGTGAAATGTATGTCTGAGG
AAGAAGCTATTAGAGTCGGTGGTACTAATCATAGCCACGCGACCAAGGATCTTTACGATTCAATTGCTGCTGGAAACTATCCTGAGTGGAAGCTTTTTAT
CCAA

chr12 63,319,518 C T C
TCATACTGCAATTACCCACAA
TCCTCATCTGTATCATTAGTTGCT
21
24
21
57.26
80
ACAGCCTCAACCACTCTCATCACAATCACATCCATACAGTAATATTTACAGAAGTAGCAATAAAGACCATATTGCTACAGTGTACCTCACAATGTTTCCA
TGCTGCATCTCTTTCAAGAGGGAGATTTCTCTAATAGCCGTGCTTGGCACACCCTCGTCTTCCTGCTCCAGCCGAATTTTCTTCAGTGCAATAGTTTCAT
TAGTTACACGATCACGAGCTTTGTACACTACGCCGTACGTTCCTTCACCAATCTTTTCAACTTTTTCATACTGCAATTACCCACAATATCACTTTCCAA[
C/T]ATAAGCATCAGGTAAACAGAAAGCAACTAATGATACAGATGAGGAACTCCTTACCTGGTCCATCTTAGGTCAAACTGGATGGACTCCTGAAAGGCA
AAGCAAGAGGAACAAAAAGGAAATTCAGATGAAAAGTAGTGAGAAAGAAAATTTGACACAGATACCTTTTAAGTCATTTTGATTAAGATCAAGTGCATTA
TCTGTTTTTCAATCAATTTCTTTTTAGATGGATCAACATTCAGTTCAAAGTTGCCACTACTAAATAGGAGCAGCGTAAAGGGGAAAACGCCAGAAATCCC
ACTC





logout