Home > Solanum lycopersicum >MAB      


Information

Crossbreeding combination : 258 X     Marker selection method (distance) :
Search

MAB viewer     Marker(#) : 74


MAB marker Information     Marker(#) : 74

Chr. No. SNP position Ref SRR1572485 SRR1572486 Left Right Sequence Primer Size TM Product Size Detail info
chr01 2,255,882 T T C
ACTAGCACAGCCTTAGCAGG
CCATTGAACAGCATGGCAATG
20
21
20
58.72
85
TCGGACTTGCTCTGGGGTGAATAATTCAGTCATTGATACACCCTTTATTGTAGGCTTCCCAGACTTAGATCCACTGGTGCTTTCAGAGGGTGCTGACATA
TTTTCCTGTTTAGGCTGAACAATGTCCTTTTCAGTCTTAACATTTTCCTGTTTCACAAGACAAGCTGCATTACTTGATACAACAGAATCACCATCAGACT
TCCGAATGCAGGAACCATCCAAATTGTCATTTCGTATGTCAATACTCCTGGGACTGACTAGCACAGCCTTAGCAGGAATTTCCATCATTGCGTCAGTGA[
T/C]TTCAGATTTCATTGCCACAGCATTGCCATGCTGTTCAATGGGCTGGGCATTTTGGGTAACGTGAGACTCACTGGCGGTAACTGACATAAAACAATT
TTCAGTTTCCACGATAAGAGATTGAGAAGGTTGCTCAATCTTCGGGCGCTTAACTGAATACTGTAAATCTTCTGTTTGAACTGGCACTGAACCCTGCTTG
GCAGTCAACCTGGAAGCAATCTCACCGGTACCATAGGATCTACAAGTACCATTAGCAGAAGATGGCATATCAGAATTGCAGCCAGGACGAGCAACTTTCT
GTTG

chr01 71,056,329 G G A
GCATAAAACTCAATGCTAGCAT
CTAAATCTTGAAAAACTCCCGTCA
22
24
22
57.45
81
TATCTAGCCAAATGTGACAGATAATGTTTCTTGCTGAACAGGTGATTGTTGCTGCTGCTGAACGTTGTCTTGATCCCATCCCCCTGGAACCAGCCATCTT
GGACAGGCTTACCCAAGCAAAGTTGGCAAAGAATTCGGACCAGAGCTCTACTTCATAATTATCTGGGAGGCTGGGAGCTCAAATGCATCATTCTACTGCG
ACTCTGAGCTGGAAGTAATCAGAAAACATAACACCCAATGCATTTTTTAATAGGTAAAGCATAAAACTCAATGCTAGCATATATTAGAAGAAAAAACTT[
G/A]CTTTAAAGCCTTTCTTGACGGGAGTTTTTCAAGATTTAGAGTCATCGAGTTCAAAATGGATGTAACATGTTATATGTTCACATTTTTTATTTTCTT
ATTACGTATGTGTAAGTGATTCGACTCGAAAATAGTGGATTCAATTAGTTCTAATTGAATCCTCTATAGATATGCATTCACCATAGGTCCATAGCATATG
CATCACTTTGATTGAAAATGGAAGCATTGTCAAGCAACTGAATTCATGGATCACTAGTTCATTAAGGGGCAGCATTTCCAATTGAAAGAAGGGGTACAGT
GGAT

chr01 72,827,114 T C T
GGACAATTAAACCTTGATTGCTGA
TGGAGATAGCGGATTTGCAGT
24
21
24
59.51
81
AAAAGGCGTATAGACCTCTGTGTTCTTGGCATTGTCTAATGCATACTGCGCAATCCTCCATGCCAATGTCTCAGGCACATCCGATTCCCATGAATCCACC
CCCGCATTCACAATTGTTTCTAACTCAAAATCATGAACATTATCAAACAATCCATCGGTTCCCAACACGATCACATCCCCTGCAATCACTGGAACACTGA
TTTTCTCCGCTACATTCGGCTTATCAGAGGTGCTCTCATTCCCCAATTGAAAAGGACAATTAAACCTTGATTGCTGAACTTTCGATTTGTACACAATTG[
T/C]CCCCTCTCTTATTACTGCAAATCCGCTATCTCCAATGTTAACAGCGTGCAATGTGTCATCGGAAAGAGACAGAATACAAGCAGTAGAAGAACCCTT
ATTCTTTGTTTTCGAAAAAGCTTCATTAAGAACTTTCATCAAATCAATACTAGTAGTAGTAGTACTATTACTCTGTTTGTGAATTGCCAGTTCAGCGTTT
TTCATCAATTCCCTTGAATACATACCTGAATCGATACCCTTTTTCGCCCACCCACCAACACCATCAGCAACACCGATCACCTGTTTGTTAAGGCAAATAA
AACT

chr01 81,988,468 C C A
CGACCAACTGCACTTGCTTC
CAACAGGAGGTGACCCAACA
20
20
20
59.82
97
CAAAACACCAAATTTTCTAACTGCAGTCAATGTTTAAATTGTGTATATAGGTTTATCAACCATCTGAAGAGGAGCTTAGGGGTTACCTTGACCCGTACGA
AAATGTATTATGTACAGAGTGTCAGCAAGGTGGGGATGATGCTCTTATGCTACTTTGTGATCTCTGTGATTCGCCTGCGCATACTTATTGTGTTGGTCTT
GGACATGAAGTACCTGAAGGTAACTGGTACTGTGAAAGCTGTCGACCAACTGCACTTGCTTCTTTAAACCCACAGAATCTGAATCCTATGCCTGATAAT[
C/A]GAACAAGCGGCAGTTTTTCTGTTGGGTCACCTCCTGTTGCGAATGTGAGAGAAACGTTTGATCTTAATGAAATGTATGTTCCTGATACCCCTTTGA
CCGAAGAATCAGGTGATTTTCATTCTCCGCGAGATGGTCAAGTTTCTTCTCTAGCTTCTGGGATTGGGGCATTTACAGTTTCTGACCGCCGCAGAATACA
ACGGCAAATACATCAACTCCTTAATAACAGGAGGAGACAACTTGGTAATATTGCTGGGACCTCGGGTGCTGTATCAGGGAATAGTCTCTTTGGCTCTCAA
ATTG

chr01 82,312,267 C C T
TCAGCATTATCACAACTAGATGA
AATTGTCGTGATAATTCATCCATT
23
24
23
55.22
80
CCCAGCTCCATCTGATACTACTCCTGGCATTCCAGAATGATTACTGCACATCACAGTTCCACTTTTGGGATCCTCTACCCGAGATGTTGCTTGGTCTCCT
TCACTAAATCTACTCATATCTATCTGACCATGCTTTTGCTCGGTATCACTGGAACAGGAGTACCCAGAGTTCCCACCTTCGACACCAAACTCACCGGCAG
CCTCAGCTTCAATGAGGTTACTATAAGATGTTCTTGAAATATTACCATAATCAGCATTATCACAACTAGATGATTTGCTCAAACTATCAGATGGTGGTG[
C/T]TGATGAAATGGATGAATTATCACGACAATTTAAATTCAACTGAGACTCCTTTTGAGGCCGCCGATATAGATCAGTTCTCTGTTTCCTAAATGTGTT
GCCCAACCCAAAACCGCTGAAGTTCTCCATAGAAATAGAGAAGGTACACGCAACAGCTGCAGTAGGCAAAAGATGCAGATTAGGACTTAGCAAGACCAAT
CTTCACATACATGGTAAAACAGGAAAGCTCTAACTTAATCTCTATCAAGTGAGATCAGTGTATACATAAATATGTAGAAATTTCTTTCACTTAACATTGC
TAAG

chr02 28,427,191 T T C
TCCACGACCTGCTGCCTGAG
GCCAAGAATTGTAGTTGTGGTGA
20
23
20
59.43
83
ATTTCATTCGAAATTTTTGGATAACTTTTCCCAACAAATTGACTTGTAGTATTCGTAGAGACTTGTGGGCAGAGCAACTAGACACTCAGCTTCTCTCAAA
TCGTAGTTGAAATTCTAAACCAAGTGTGTTCCTTACTACTTCTTAGATTACAAGGGAACAGAAGCGTATGCCAATACAATAAACATAAGAAAATCTCAAC
CACATCATATGAAATCCTGCATGGGTCAATCATCTTCTTACAGGGGGTACAGCACCCCGACCAGGTGCTGCTCCACGACCTGCTGCCTGAGCCTGCAAA[
T/C]GAGATATAATACTCAGCTACATTTCATTAATTCACCACAACTACAATTCTTGGCTAACAAATTCTTCATGACATCCTTCTATTTTTCTACATAACA
TCCTGACCTCCAGCAAAAGAAAACGCGGATAAGAAATCCCACTTGAGTTCTTGGAAGGATCACAACTCCCAACACCAATCTAAAGCAACCAGCAAGATAC
TCATTTATAGTTTCGGTGAAATAGTCTTACTGGTACAAGTAAGGAACATAGTAGAAGTAAATCGATCACCTCCCCTCTCAGTTTTACCGTCAACTACCCC
ACCC

chr02 37,381,272 T C T
TGAGCATGACCTTCTCCACT
ACAAACTTGTACGCAATTTATGCT
20
24
20
58.23
83
ATCAGAAGAAATAATGTGGACCAAGAACAACGAAATCATAGAACTGATAAATATATATCCTGGTGATTGGACTCTCTGCTGACTGCTACTTGTGAGCTGT
TACAACTTAAGAGAAGAGTAACTGAAAGAGTCATTCGACCAAAGATCTGCAATGACAAATAGAGCTAGTACCTTGGCTGCATCCCATATCTTCACAGTTC
TGTCAAAGGAAGATGTTGCAAACACTGTTGAGTGTGGTCTAAAACGGACATCTGTAACGTGGTGAGCATGACCTTCTCCACTATAAACATTGTTAGTTC[
T/C]CAACTTCCAAATCAGTACCTAAGCATAAATTGCGTACAAGTTTGTTAACAGGAGAAATTGAGATAAGGGCTCGCCTATTCGACCAACTAGAATCCT
GTTGAAGATTAATTAGACAAACCTTCTTGTCGTGTCCAGCAGCAGCCAACAACTCTCCTTCTGAATCGAAGTGGCAACATAGGAGCTTGCTAGTGTTTGT
GTGAAGGTTGCTAATCGCTTTCAATGAATTGCCTGCATAGCAAAATGAAGTCAATTATCCTTTATGCCGATATGAGATAACTAGCAATTTATCCATCAGG
GTAA

chr02 38,064,186 A A G
GGGGAGAGGACCGGAGTATT
ACGGGTAGAATGTGCATCTTCA
20
22
20
59.76
83
TATATTCCAGATTCATTAACACCAAAAACCACACCTTGGGTGCTTTCTGTCCCATCCTTTTCCCTGCATGTTGTACATTCTTTTACTTGTCTATCATCTT
GCACTTGGTGTCCTACCACCCCACTTTCAAAGCACGATGAAAACAATCAGGATTATATAGATCATGGAATGTTTAGTTGTAGGCTCCAGTTTTTTTTCCC
TTCCAATTATTTGATTTACTTCTTGAAGCTGAAAGTAATATTTTACAGCATGGTATTTTGTTTACTGGGGGAGAGGACCGGAGTATTAAAGCTTGGGAC[
A/G]TTACTAGTGGAAAACTTGCATATAGCATTGAAGATGCACATTCTACCCGTGTGAAAGGCATTGTTGTGCTACACAAAAACAGTGATGGTGATGCTG
AAGATCATCAACACATAGTAGCATCAGCATCATCAGATGGGGTCATACGTGTTTGGGATGTTCGCATGACTAACAAAGATAAGCCAAATCCACTGGCTGA
GGTCAATACAAAATCCAGGCTGACTTGTCTGGCTGGATCATCCATCAAATGTGAGTCTTCCTTTGCTATTTGAATTTTCCCCTCTTGAAATGTTTGCCTA
ATTT

chr02 39,891,992 G G T
TCTTGATTGCTTGGAGAGACGT
TGAGGCTCAAAACCCATGTCA
22
21
22
59.86
99
ACTTATATCACTAGGCTTCCTCCATTGAGTGAGGAGAATGAGGCGGAGGGGCCATATGCCGTTGTTATGGCCCCCACACGAGAACTTGCTCAACAAATTG
AGGATGAGACTGTCAAGTTCGCACACTATTTGGGTATCAAAGTTGTTTCTATTGTTGGTGGGCAGTCCATAGAGGAGCAAGGTTTTAGGATTAGGCAAGG
TTGTGAAGTTGTGATTGCAACCCCTGGGCGACTTCTTGATTGCTTGGAGAGACGTTATTGTGTTCTGAACCAGTGTAATTATGTTGTTCTTGATGAAGC[
G/T]GACCGTATGATTGACATGGGTTTTGAGCCTCAAGTTGTTGGTGTACTGGATGCTATGCCTTCAAGTAATATGAAACCGGAGAATGAGGATGAAGAG
CTTGATGAGAAGAGAATTTATCGAACCACTTATATGTTCAGTGCTACCATGCCACCTGCTGTGGAGCGGCTGGCTAGAAAATACTTGAGAAATCCTGTTG
TTGTGACTATTGGCACTGCTGGAAAGACTACTGACCTCATCACTCAGCACGTGTTTATGGTAAAGGAATCAGAGAAAATGTATAAACTGCAGAAATTGCT
GGAT

chr02 41,786,529 G G A
ACAAACCTTTCAGTTCCCCA
TAGCGCCGCTGAGCAAATTA
20
20
20
60.46
83
ATCATCAAACACCATTAATATTGTAATGCTAACACAAGTCTAACAACAACAAAATGGATTAAAAATGAGTGTTCTAATTCACAGAAATACCAGCTTAAAT
TTCAAACACACTTGAAGTTTAAACAGAAACAGCTACACAATATCAAGCAAGCAACTAAACCTGCTTTAAGCATGATTTGCAAAACCCAATATGACAATAA
AATCCATTTGAGAAAAGGAAAAAGAATGGTTAAGGGCTATATCAAGAGTAAAACAAACCTTTCAGTTCCCCATTCTTCCCCATCTGGTCAAGCTTCTCC[
G/A]CATATTTAACTATTCTAATTTGCTCAGCGGCGCTAAAGACACCCTTATGTAGCTCCAATCCATCAAGTATATTCACAATTTTCCCCCTCACCCTCT
CCAAACATATGAAATCCTTTTTCCTCTTCACATTACAGAATCTAATGTACTCTCGTTTCTCCCTTGACAATTCTGTTTTTTGCTTACTCTCCGGATTAGT
AATTTCCTCTTCAGCCACACCATTCACCTGACTTCTCAAGGCAATTGACTCACTCACTTCCTCAGCTTGAAGTTCATCCTCCTGAGCCATATCAGCCCAT
GACA

chr02 48,305,259 G A G
TCAGCAGGACATTGTTCAACA
GGCAACATATGTCTCAAATCACT
21
23
21
57.18
88
TACAATTACTTGTAATTGGCTTACAAGATGATTCTATGAAATGTTTTCTCATTTTTCAACTTACTTAGAAGAATCTTTTTACGTTATTGCAACTTATCTT
ACTAATTAATTAGGTATTTGAATGACGTGGACTATTACGGAGGATTCGAACAAGAAGATCTAGATCAATTATTTGAAGCAATGAGATCAAATTACAAGGC
ATGGTGTTCAGGTTTTGCACCTTTAGCTATAGGAGGGGACATGGACTCGGTTGCGGTACAGGAGTTCAGCAGGACATTGTTCAACATGAGACCAGACAT[
G/A]GCATTAAGTGTGTTACAAATTATATTCCAAAGTGATTTGAGACATATGTTGCCTCATGTAACTGTTCCTTGTCATATAATTCAGAGCATGAAGGAT
TTGGCTGTGCCTGTCGTAGTCTCCGAATACCTTCACCAGAACCTCGGAGGCGAATCCATTGTGGAGGTGATGTCCACCGATGGACATCTGCCGCAGCTCA
GTTCACCCGATGTTGTTATTCCGGTGTTGCTTAGGCATATTCGCTTTGATATTTCCGTTGATAAATAGTTACTTTATTTTGGATATGTACAAAGTTAATT
TCTT

chr03 1,779,721 C M C
ACACGGGGTTTGATCTTCCC
TGCTGTCCTACAAGGGGGTA
20
20
20
59.88
80
TGTGGATCACAGAGCCAGAGCCATACCTATGTCGCCGTAGGAGAGGGCATGTTGATTTCGGATTTGGTTGCGAGTTGCAGACTGGAAATGGTGGGCTGGG
TTTCGGCTCGTGGCCTTTCGGGGGATAATACTTCTCTTTCGAGCATTGAAGGTGCCCTGAGTTATGGATTTGAACTTTCTTGGAAACGTACCTTCTTGTG
CAGAGAATGTGAAGCGAGTCAAGGCAACTGTTTTGCTGTGGGTGACCGTTATACTTGCAGCCACCGCTGCTACGATGACACGGGGTTTGATCTTCCCCT[
C/A]CCTTGTAAGTCAAAATTCACTATGTTGAACTCATTCATACCCCCTTGTAGGACAGCATTACCACTAGGTAGAGGGAACTCAGGGCACTCATTTGCT
TCTCTTGGGTGCACTTTTAATTATATTCTAGTTTTGTTTTCAATTTCGCAAGATAGATATACATATATATATATATATATACATGATTTTTTTTTCAAAG
TTAATGGTGGCTGCAAGTGCACCCCACTAACAAGTATGTGTCCGCCACTGTGAAAACTTACCACCTTTCCTCATACTCCACTTGTGGGACTACGCTGGGT
ATGT

chr03 1,889,647 A G A
AGCTATAGCCTTGTTGAACCT
AGCATGCAATATCCACCTTGA
21
21
21
57.7
98
GTTCCCTTTTGTGGTTCAAAATCTTCTTGATGCATTTTAATTGGCCAAATTTCATAAAAAGAAAGACATACTTCTTGCTGTCTTTTTCTTCTTTTTTGGT
TTCCTCTCAAGTGACTTGGTTAAATAAGATAGTTGGTATATTAGTCAAAGCAATGTTCTGAACTCGTCCACCCTAGGGAGCAATGTTTTCCTCTTGTGAA
TTGGTCAGCTTGTACAAACTTTAGTGGATTTGAATTGGTTATTCTGTACTCAGATGCTTGTGAGTTGAACTAAGCTATAGCCTTGTTGAACCTACAGAT[
A/G]TGCGCACAGCTGCTGTTGCGAAGGAAGCTTTGGAAGGACATTCCATATATCAAGGTGGATATTGCATGCTTCATATCTCTTACTCTCGACACACAG
ATCTTAGTATAAAGGTAAAAGCAGCTTTGTGGAGATATTAATTTGTGAAGGAACTCTGTAATTTAGTGTCTGCCATCTCTCTTTTGTTCATTACTTAATA
CCCTCCAGCTTCCCGAGCTTTCTTTCCCCATTTCCTGTGAGGGAACAATTCACTGCCTAATTGAATGGTTATTTTTACTGATTTCAGATTAATAATGATC
GCGG

chr03 56,439,200 C C T
GTGTTGTTACAGTAACCCTTCTGC
TTTCAAGTCGCCATGTGGTG
24
20
24
59.05
82
TGAAAGTGCCACAAATTTCAAGGGTGCGTATATCGAATAGATTGTGCAAGTTGTCTCTCCCACTGGTTAATATCATGTTTCCATTCCGAGAGAGTGAAAC
TGATGTAACAGCCTGTGAATGTGCAGCAACTTCACTCAGAAGCTTGCCTGTTTGAACATCCCATAATCTAAGATTACCATCAACATGACCAGAACAGATA
GTCAGGGCATCCATGCTAAACGCAAGACTGTTACAGTTACTGTGAAATATGATAGTGTTGTTACAGTAACCCTTCTGCAGATCCCAAACTTTTATTGTG[
C/T]GATCATATGCAGCACTCACCACATGGCGACTTGAAAATTTGCTTACATCAACTGCACAAACCTTGTCCATGTGCCCAGTAAGAGTGTGCCGTATCC
TGCCTGAATTTGCATCCCACACATACAAATTATTTGAACTACTTGCTGCTATGATGAATTTGTTATCATGTGTAACGGAAAGATCAAGAACAGAACCCAG
ACAACCATAAAGACTGTTGGTTAATGATCCGCTTGTGGTATCCCACATTTTAATTGCTCGATCCTGACCTCCGCTTATCAATTTACTTGAGTTATACTCA
AAAA

chr03 64,291,488 A G A
CGCAGGGGTTCTATCTTTGGA
TCATGTTGATTTCTTTTTCATCCA
21
24
21
55.52
81
ACCAAATAGTGAGACATGATATTGCAGTACACTTTCCAAAATATGATTTGACTTTGGTTAAATGTATCATAATGACTTCACCTCACTTTCGGCTAGCAAT
TGCTCCAGTGCCTTTGGTAGATATGGAAATACAGATGATCCCAGTATGTCCACCATGCGGTGAATGAATGATGTGACCTAGGAAGTTAACATCATCAGGT
AAGGAAATGCATCACCAAAGGTGCATCAAATAGAACAAAAATAACAAGAAACCATACCTTGCACCGCAGGGGTTCTATCTTTGGATATATGATAAGAAT[
A/G]CGTAGAAGGACATCCAATGTCTGGATGAAAAAGAAATCAACATGATAAGAATTGATGCATAAAATCAATAATTGGATTAGGGCATTATTTAACCAC
AAAAATTTAAAATCTGTCTCCCTACAACGGGTGCACCAGAAAAACAAATACTGCAAAAAAAGGAAGGGGAATAACAACACACTTTGTCATTCACTTATTC
TGAGAACAAAGTAAACAACCAAATATCCATTGAAGTATAAAGACAGCCAATCCAGATACCAGCCTCCTTAAATAGTGACACTACTGAGAGGAGAATATTC
AGGA

chr04 3,054,192 A C A
TCATGTCAAGTTGTGTATTAGGCT
GCCAAATTCTTTCCTGGATGGC
24
22
24
60.42
99
TCATATATGTAAGGATAAGATGAAGTGCTAGCGAAGTTATATTGTTCCTTGGATTGTAACTAGCAGCGACAAATGGTTTTGATAATTTTCAAGTCCTAGA
AGACTTCTATTGGCTTGTGGATATGCTGTACTTGCACCTAAATACATTTACATTCTACTATATACCGCTTATCATTACTACTATCTCTGATATGCCTTTC
TGTTGAAGAAAAGTTAATATTTATTTATGGTATACCTTACTTTCATTTTACTCTCATGTCAAGTTGTGTATTAGGCTTTTAAGAAACTCTTGAACATAT[
A/C]TTTCGGATAAAATAATTCCTTCTATTTGTAGCCATCCAGGAAAGAATTTGGCTTGATGGTGAACTACTATGCAAGGAGGGGTGACATGCATCGTGC
ACGTGAAACCTTTGAGAAGATGTGTGCTCGAGGAATAGAACCAACCTCTCATGTATATACCAAGTTAGTTCACCTTTATTAAATGTTACTTCGGTTCTAT
CAATCCATTGTTAGACACTCTTCCAGTTAATAACCTCATAACTAAATCCTTATGGACGGATCCAATCTTGGCCTTGTATTTGCTCATTCTTCAGTCCAAC
ATTT

chr04 3,636,527 C C T
TGCAGAGTGGCTTTATGCTCT
TGACATAGGCCAAGAGGGGA
21
20
21
59.96
80
TGAGACTGCCAGAACTTCCTAAGATTGACGTTCAATCTGCAAATCGGAAGTTGTCCAACAATTCCGATCCCGAATCACCTGTCTCACCACTATTGACATC
TGATCCCAAAAATGAGCGTTCTCACTCACAAACTTTTAGTCGTCCTAACAGTGAGTTTGATGACTTCCCTAATACATCCGAAGAAACAAAGGATACAGAG
AATCGAGAACCACCATCCTTCTGGAGACTTGTTGAGCTTAGCCTTGCAGAGTGGCTTTATGCTCTACTAGGGAGCACGGGCGCTGCAATATTTGGTTCC[
C/T]TTAATCCCCTCTTGGCCTATGTCATTGCATTGATTGTAACAGCATATTACACAACAGATGATAAACATCACTTACAGCGAGATGTTGACAGGTGGT
GCCTCATCATAGCCTGTATGGGTGTGGTGACTGTATTTGCCAATTTTCTGCAGCACTTCTATTTTGGTATAATGGGAGAGAAAATGACTGAGCGAGTTCG
GAGGATGATGTTTTCTGGTAATGACTAATTTCAATTAGTAACTGTTCCCTTCATAGTTTGTTTTGTTTTACATTTGTACTTGTGTAAATATATGCACTTA
TAAT

chr04 7,791,162 T T C
CTTCATTGGAGCCCCCTGAT
TCCCTTAGGTCCTGCTCACT
20
20
20
59.59
88
TTTATTAGACAATGCTGGAGCGCAATCATTTTTCTCATACTCCAAGAAGCTAATACTGTACCGTTTACAGTTTGAGATGTCTACCCTCACTGTGGCTAGA
TTAGTGACATCTTGTTGCATCTTCTCTTTCCTAATGATCTTCATTAACTTAAAAAAGCTAGATTACTATCTTGTTCATATTTTTGGCTCGAGAAGTGTTG
TCATTGTGTTACCTGCAATGCTTGCAGAGTTAATGATCCTGTGGCGATGAAGCTACTTAATAAAGCAGGTGAAATGCCTTCATTGGAGCCCCCTGATGA[
T/C]GAGAGCATTAGAACCCTCTATGTGGGTGGTGTTGATGCAAGAATCAGTGAGCAGGACCTAAGGGACCAGTTTTACGCACATGGAGAAATCGAGTCG
ATTAAAATGGTGTTGCAGCGTAGTTGTGCTTTTGTAACCTACACTACAAGAGAAGGTGCAGTGAAGGCAGCTGAGGAACTAGCAAACAAGCTAGTGATAA
AGGGCTTGAGACTGAAGCTGCTCTGGGGGAGACCACAAGCTCCTAAACCAGACACCGAACTGTCTGATGAAGCACGTCAGCAGGCTGCAGTGACTCACAG
TGGA

chr04 21,084,365 T T C
TGACCCAAAAGATATATTGACCAG
TGTGAGGTGAAGCGATCTGC
24
20
24
60.39
95
AATATAACTTAATTAATAGAGTTTGAACCCACATCATTGACCGCTAGGCTTAACCTTTGAGTGCGTTAATTTCTCAAGGCTAACGAGTGCTTTTGTAGGA
GAATTCAGTCATGAAAGGCATATCATATGCCTTACAGGATAGTAATATATCAGCTTAAAATGATTACATATAAACAGGGCATTTTCCCAAAAGAGAGATG
GATCAGTTTAATACATATACATGTAAACATACTATTGACCCAAAAGATATATTGACCAGTTTCTGGAGCTGATAATATAACAAAAACATGCCATTTTAC[
T/C]TACTTCATATGCAGATCGCTTCACCTCACAGCCAGATATTGCACAAAATGACAGCTCCTGACATCTACTCCATATAGTTAGAGGTGAAGCATATCA
GAATGAGCCTTCATTCCCTATTTGGTGTTAGCTCTTCTCCTTCTGGCACTAAAGTTTGCATCAGCTGCGGACAGTTTAACATGGTCAACATACAACATCC
AAGTGAAGGAAGGAGATTACAGCAAAAAACGCTACTAATGAATATTCCAAATTCATATACTTAACACTATGTTAACGTTACGATACCTTCCAATCATTGT
AATC

chr04 23,004,789 G G A
CTGTAATGCTGGTAACCACTTGC
GCAAACTGCAAGGAGGACAT
23
20
23
58.75
80
TGTACTAGTTACCATCCCATAACGTACTTCAACCTCCCCCCTCCTTCCCTGGTGCATGGACCCAAGTTCTCATGTTTCATTTTGCTGTATTTTCTCAATT
TCTCATGCTTAAATACTTGTCTTTTCTTTTTGATATTCATTTTGTCCTTGTTTACGCAATGGACAAATGATATTAGCGAAAACGCATCACTTAACATGCC
CATGATGAATGAACTTCTTTACTGATTTTCATCCCTAATTATTTATTTTTTTGCATCAGGTTTGGCAGTAATAACTGTAATGCTGGTAACCACTTGCTT[
G/A]ATGTCATTGGTTATTGTTTTGTGTTGGCACCAAAATGTCCTCCTTGCAGTTTGCTTTGTTATCTTCTTTGGGACAATTGAGGCTTTATATTTCTCT
GCTTCTTTAATTAAGTTTTTTGAAGGAGCATGGGTGCCTGTTGCCATTTCTTTAGTTTTCATGATAGTGATGTGCATTTGGCACTATGGCTCACTGAAAA
AGTACGAGTTTGATGTTCAAAATAAGGTGTCTATTGACTGGCTACTCAGTGTAGGTCCCAGCCTAGGTATCGTAAGGGTCCGTGGCATTGGCCTCATATA
CACT

chr04 23,182,873 C C T
ACAAGTGTGTGCCTACCTTTCT
AACGATCTGCATGGTCTGGG
22
20
22
60.11
126
CGAAAGATTATTGTTGCAAACATGCTGCCTTTGCATGCTCAAAGGGATACAACAGCTGAAAAGTGGTGCTTTAGTTTGGACGAGGATTCACTTTTATTAC
AACTGAAGGATGGGTTTTCACCTGAAACTGAGGTTATCTATGTGGGTTCTCTCAAGGTAGATGTAGAGCCCAGTGAACAGGAGGAAGTTACACAGCGATT
ACTTGAGGAGTACAAGTGTGTGCCTACCTTTCTACCTTGTGAAATCCAGGAAAAGTTTTATCATGGTTTCTGTAAGCAACAACTGTGGCCTCTTTTTCA[
C/T]TACATGCTCCCAATGTGCCCAGACCATGCAGATCGTTTTGACCGTCAGCTGTGGCAATCTTATGTCTCAGCAAACAAGTTATTTGCTGATAAGGTT
ATGGAAGTGGTTAATCCCGAGGATGATTATATCTGGGTTCAAGATTACCACCTCATGGTTCTTCCCACATTCTTAAGAAAGAGGTACCATAGAGTGAAGC
TTGGGTTCTTTCTTCATAGCCCATTCCCATCATCAGAAATTTACCGGACTCTCCCAGTTAGGGATGAAATTCTAAAAGGATTATTAAACTGCGACCTGAT
TGGT

chr04 27,044,795 G G A
TTTGCAAAAGTTGTGACCAAT
GGAAGAGCCTGATAACCACT
21
20
21
56.62
92
GACGTATGAGGTGATGAAGTCAACATAACCAACTTAAATGTGTAGGCCTGATTGTCCCTGCATCCTAAAGAAGAGAACCAACAATTGTTTGAGTCTTAAC
TCTTGAACTTAGTATTAAACGTCTCTGTCTGATCTTGTTCTTCTGGTTGGTGGCGGAAAATGTGATACAATATCATGCCTTTTATGACCTTTGTGGGCTT
AGTTTGGTGAATTTACCGCACCGACAGCCTTAATGTAATTTTATTTTTTAAATTTCCTTTTAGCTGGAACCGATTATTTGCAAAAGTTGTGACCAATGT[
G/A]GGATCCTCTAATGCATGCTAGGTTCGCTACTTGAAGATAATTGAAAAAAGTGGTTATCAGGCTCTTCCTTGGGTGCGATATATTACCATGGCTGGT
GAATATGAGTTGAGACTTGCGTAAAACCACACCGAGATGATGATCCAATGCAATTAAGTTTGCCCGAGGCTCGGATAAGTCACGAGCTCCAATGCTTTGA
GCTGTTTTTCAGGAGATGAACTGGTTTAGCTCATAGATTTTAAGCAAATTGTTTTGTTGTGCCAATTTGTTATTTATTTGACTTTATTACTTGTATGCTA
GCCA

chr04 29,699,954 C C A
TCAGTCATGACCATCATCGTTG
TGATGGGTGATGGTGACTGT
22
20
22
58.64
84
AAACAACATATCTACCTTCACAAGGTAGGAGTAAGGCTGCATACACAACCCTCTCCAATTCCATCTGTGGGACAACATCGAGAATAGTGTTGTTGTTACC
GCTTAATGGGTCTGAATAGATTTAAATGATTAAGATCTGTAACAAAGTCTTAATATCATTAAGATGATGTCTTTTTAAGGTTCTGTATAAAGTTGGCAAT
TCACTGCTGTTTTTCGCCCATTGTTGCTGCCCACAATTATCAACTACCTCCTCCCACCACTCATATATACTATTTTCAGTCATGACCATCATCGTTGTC[
C/A]GTCGCTACAATCCGTCACCAACACTCCTAACAACCATTTACAGTCACCATCACCCATCATTATAGTAACAATATTATTATTGACAATCACCATCAG
TCTCCACTATATATTATCATCATCTGCCGTCATCATTCACAAGCACCATTAGCTATTACTATCATTAACCGCAATTATAAGTCGTCAGTATCATAAACCA
CTATTTTCAGAAATCATCACCATATCTACTAGACTACTAAACTCACAAACACCACCATTAGCCTAACATTATTCCCAATCGTCACCCACACCACCACCAA
GTGC

chr04 30,682,574 T T C
AAGACCGGCTAAGTCACTGC
TGGTCAACAATGATTAATGGCT
20
22
20
56.3
150
TGCAATCATAACATTCCAAGAGATCAGATCTCTCTGGCCTCTCAGGCCATCATCAAATATTTTCCTTGCAGTTGCTACGTCTCCACATTTTGAATACATG
TTTATAAGTGCTGATATGACAACTTCATTCATCTGATATGTTGTTTTGTTAATTACTTGGTGAATTTGCATTCCCTCACTAAGACCGGCTAAGTCACTGC
AAGCACCCAAAACACTCACAAAAGTTCCTTCATTTGGTTTCACCAAAACATCCATTTGCATTTCACAGAAATTTCTTAGTGCTTCTTCACTTCTTCCCT[
T/C]TAGCATGTAGCCATTAATCATTGTTGACCAAGAAACCACGTCTCTCTGCCTCATTTTATCAAACAATATTCTAGCTCTGCCGAGTTCCCCATTTTG
GATGAATCCCATGATCATAGTATTCCACGAAGAGACGATCTTTTCTGGCATAATTTCAAACAGTTCAAACGCTTCATCAAGTCTCGAGTTTTGTGTATAC
CCAGTAATCATTGCATTCCAAGAAACCACATTGCGTTCAGGAGTCCTATCGAAAAGTGTTCTAGCCTCCTCGACTCTCCCATTCCTTGACAACCCTGCTA
TCAT

chr04 45,680,985 C C T
ACTGATGCACCTCCCTTTTCA
GGTGGGTATAGAGAAGGCTGT
21
21
21
58.6
111
ATATCACGATTTCGAGCTTTATGTGTATAATTTCACGAGAAGGTTTCAATGGACAAAAAAAACATGGTTAAATCACCTTTTACTCCGAGACAATGGACTC
AAACCATTACTCGGCTTTTGCTTTTTCATTTCCATTTGTATTTGCATGTGGACCACATGAATGATTTTGCACTGATTGAAATTTAGAATCAAAGCTGCGG
TAGACGATGTGCTGCTATGGGAAACCCTCAATGACTTCAGTAGTGCGTGGAATTACTGATGCACCTCCCTTTTCATTATCAATTCTTCCACAGCACCTC[
C/T]GGCCATTACCATCGTTTCGAGAAAAAGATTTCCATCATAGTTGTACAGCCTTCTCTATACCCACCTGAATTTTAATTCCGCACTCTCCGTCTTGAA
TAAAATGTATAACTGCGTTTGGGCCGATGAGGATCGAACTTGAATTGTCGCCCATTTCAAATGTTCTCTCGTACGTGTCACATCATCTAGACTCAAAAAA
CCCCTACAGTGCTTTCCAATAGCTCAGATAGTGTCTCCCCGCAACATATGTGCCAGGAAGTTCTATCGAATCCATGTAGTTGGCAATATTATTCTTCAAG
CATT

chr04 49,714,285 A A G
GGCCTTGTTTCTTCTGCGTG
AGGAGATAAAAAGAGCAGGCCA
20
22
20
59.42
94
CTTAATGCATGTTGAATGCAGCTCAGTGTTCCCAAGTCGACCAGTGGTGGGGCTTCCTGTTGAGTAACCCAAGGGATTTTTCATTGCTTTGGCTGGATTA
CTTTAATGCCAACTATTTGAGTCAAGACTTCTTTCTTGATCACCTTGTTGAATTCTTGGCTGTCATCAATTTTAGTCTTGGCTTCTGATTTTTATTTCTT
TTGAACTCTTGGGCCTCTCTTTATTTGATCTGGCCTTGTTTCTTCTGCGTGTAACGTCTTCTATCATGATATAGAGGTTGGGCACAAATTGTTCATCTC[
A/G]TTTTGGCCTGCTCTTTTTATCTCCTCTGATTTCTTTTGACTTCTTCCTTCATTGTCTCGGTTCGTATTTTCCACACATCTTTGGCTGATTTTTCTT
CCTTCTGGTTCTCGTTGACTGACCCCTTACAACATCATTATTAAGAACTTCTCATGATTGTCCCAGAAGATCAGTAGTTGCTCAATTCATTTAACCTTTT
CATTGTCAATATTAAAACTTAAATCTAACATTAACTTCTTAAATTATTATTTTATAGTTTAAAATCCATTCTTCAAAATTATTCGCAGACACAATAAAAG
ATAT

chr04 49,752,719 A A G
TGTGGATTCTTGCAGCACCA
CGAGCAGGAAAACTAGATGATGC
20
23
20
59.75
103
TCCTCCAGTTTGGCATATATATCATCACTTCGCGGATGACTTCTGTCTCCAACTATAAATGTGTAAATACTATCTTTCACTTCAATCCAACTCATACCGG
GTTCCTTTTTTACTCTACTGTTCTTCATAAATCTTCTTACTTTTGCAACATCTCCCCACAAACCAACTGATGCATAAATATTTGCAAGGAGAACATGAGT
GCCAGATTTCTCTGGTTCAAGGCTAAAAAGCATCTCGGCAGCATGTTTCCCTACCTCTACATTCTTGTGGATTCTTGCAGCACCAAGAAGAGCACCCCA[
A/G]ACAGAGGCATTAGCTTCAAAAGGCATCTTATTTACGAGCTCAATAGCATCATCTAGTTTTCCTGCTCGACCCAGGACATCAATCATGCATGCATAA
TGCTCTTGAGTTGGTTCAATCCTAAACGAGTCTTTCATTGTTTCAAAATACTTCTTGGCTTCTGCAACTAAGCCAGCATGATTACATGCATAAAGGACAC
TAACTAATGTTATGTGATTTGGAGATACACCATCTTTTAACATCTCGCCAAATAAATGAAGCGCCTGTTTCGCATGTCCATGTTGGGCAAGTCCTCCAAT
CATT

chr04 57,326,657 C C A
AAGTCACAAGGCCACGAACA
AACTTGTGTTGCCTCGGGAT
20
20
20
59.89
92
TTGGTAGACTATGAAGCAACGATTTTGATTTGGAAGATCGACAAATTTGATTTTGTTGCTTGCATGGGAGCATTTTTTGGTGTGGTTTTTGCCTCTGTTG
AGATTGGTCTTATAATTGCTGTAAGTATTTCTCTCAGCAATGCTTAACAAATTCATCAGGGAAAGCCGCGACAGTTCAATGATTGTATCTCGTTGTTTTT
ATTATTATATAGGTCTCAATATCATTTGCTAAGATTCTCCTCCAAGTCACAAGGCCACGAACAGCTCTTCTTGGCAAGATCCCTAGGACAAATGTATAT[
C/A]GGAACATTCAACAATATCCCGAGGCAACACAAGTTCCCGGTGTACTAATAGTGAGAGTTGATTCTGCTATCTACTTTTCAAATTCTAACTACATGA
GAGAGAGGTAAGACATTATTTCTTCTATGTCTAATCAGAATTTATATGATATTCAATTGTCAACTGAAAACATGCACTAATTCTGGCTTCATAGTGGCGA
AAAGAGTGTCTGATTCATGAGAATGAACTTGTTTTCCAGGATATTGAGATGGCTAACTGACGAAGACGAGCAACTAGAATCAGTTAACCAACCTAAAATT
CAGT

chr04 59,099,448 C A C
TCGCAGATCTGGTCAGACTT
AAGTTGGTGGCCATAGCTCC
20
20
20
60.03
85
AGGTTGGGTGCTGTTTCTGAAAAACTCTCCATTGTGCTAATGCAAGTGCTCAGCTCCTGCCATAGAGGTTCTAGAGCTGTGTTAATGTCCCAAACCAGGG
AGATAGTAACACCGTGCTCCTTCTCAGAAATAATTTGATTCTCGTTGTTCTTGTCACCAATTGAAGCAACAAGAGAGCTTAATGCTTGTAAAACCCTGAG
TATCACAGCGCCATCAGTTGAAGTGGTACTGAGCAGTGCTTTTTCCACTTCCCTAAACTTGTTTAGCTCATCCATCGCAGATCTGGTCAGACTTTGCAC[
C/A]GAGCCAGCAAGCTCAGTAATAAATAAATGACAAATGGCAGGAGCTATGGCCACCAACTTTTTCAGTACCTCAGCTACCAAAGAGTAAGCATTGTCT
GAAAGACTGATAAAAGAAGAAAACATTAAAAAGCTTCAATAATAAATAGAATAATACATTGTTCAGCGAGACTCGAGTAAAAATAACCCACTGAAGATTC
AAAAATTACTTGGTCATTGAAATCAATAGCGAAGTATTAGAATATCAAATAAGTGTATGTACAACCAAACAGATAATCCAATGCCTAAATAGAAGTCATA
AGCA

chr04 59,232,566 G A G
CGGGGTCCTACTAATCCCCA
CCTCCCAACAGTCCATGGAC
20
20
20
60.04
80
CACCATTGCTTTCTGTATCTGAAAACGAAGAAATTGAACACTGTTCCAACGACAATCCAGCTGTTGAAATTCAATGTTGTTGCTGGAGGCATACTGGCTG
TAGCTGCAAGAAGTACTGGAATGTTGATCAATTTAATCCAACTTTGCCTTGGGAATGATTTGTGCAGCAACCACACCAAAAAAGGTGCCACAAGACCTCC
AATAAAGCACCAATTGAGGGCACCATATTCTCCAAGGCCTAGGAATATTCTTCGGGGTCCTACTAATCCCCAGATAACTGATGCATCAAAAAAGACTCT[
G/A]TCGCTCTGACAGGTCCATGGACTGTTGGGAGGAAGCAAGTTAGGTTGGCATATGTGGTCAATGCTATTAAGTAGCCACCATGCGACACCCATATTG
ATTGTACCACCAAGTATGGTTCCAACAAGCTGTTTTAAAAAATAGAAGTTTTAGTCGGTCTCTTGTAGCATCAAGAAACAGTACAATTGCTATAGTTTCT
TCTTCTTCCTACGATCAATAGATTGGACTCCTTATGTGTCCAACACTAACCATTGACTAGTATAAGTGATTAATACTTCTAATGGAAACAATTGAAGAGG
AAGA

chr05 472,887 A G A
TCCAAGCACAAAAAGGTGAATGT
TGCGTACACTCTATCCTCCCA
23
21
23
60.06
124
TGAGAATACATGACCAAGCCAAATCATAGTTAAACAACAATGACAATGGTTGAACCAAAGAAATTGAATCACTAATAAAATTGATCAAGGTTCAACTGCT
GAACCAAAATAATAAGTTACTGAAAAAACTGAACTGAGCGAATTGGATAACTTTCAAAATCAAGTTTCCTCCATGAACAATCTCATATTCTATAGGTTTT
AAATCCAAGCACAAAAAGGTGAATGTACCAATATCATGCTGCTAATCTTATTGCACCTCTGATCAACAACAAAAACATATCCCGTAAATCCGACAAAGT[
A/G]TGGTCTTGGGAGGATAGAGTGTACGCAGGCAGCAGGCAGACCTTACCCCTACCTCGTGGAGGTAGAGAGGTTGTTTCTGAAGGACTCTCGGCTCAA
GAAGCAAAAGAAAGGAGAAACGAAATTTGAAGGAAACATGACAACTAACAGATGTCATGAAGCAATCGCCTAAGCATAATAAACAACAGAAAGTAAAAGA
TGACAAAAACAAGAAACTACATGAATAACACTATCACTATAACAGACAAAGTGCCCCAGAGGCCCAGACTACCAACAAGGCTAATCCTGTCAGAAGCAAG
ACAA

chr05 2,070,005 T C T
GTGCTCTCCCCATACCTTCAC
CTTATGCAGCAGTTTAGTTGC
21
21
21
55.87
82
ACCAACTGGAATACCCCCTGAAGTCTACATACAGATGTAACACAAGTAAGAATAATTGTAAAGAACGAAGGAATGAAATTACAAGATTAAGGTACAAGTG
TCACCATATTAGGTAAAAGAAGAGCCAAAAGTTACTAGGTAAAGGAGAATCCTACATGCTATGCAATTCAAATTTAGCTGCATCCTCAATATTTCACACA
TACCCATTGAACTTAAAAGCAAGATCATTGAACTATTTATTTTTTGTGCTCTCCCCATACCTTCACTAGAGGACAACCCAGAGCTTCACATCTGTCGAA[
T/C]ATGTGAGCAACTAAACTGCTGCATAAGCAAGATATCTAAAAGTATGCTCACTCTAAGGTGCTGAAAACTAGACTCCACAAAGTTACGCAAAATTAT
GACTAACTATATAAAGGAATACAGCAAACTACTAGATACCCATTTGATACATTTTCCAGACGTCTGAGACATGAAAAATGTAGGCTTTTTGACCACTAAA
TACAGCAAGACGAATCAAAAGAGAAATCAACCTAATTGATGTACACATTTGAGATTTTTTGGCCTATTAAGATATGACACTTAGGCCTAACTCAACTCCA
AAAG

chr05 41,689,619 G T G
TCCTTAACACGGTTAGCAAATGC
ACAGGAATATCTTGCTCCAGAGA
23
23
23
58.71
95
CTTCCCCTGACCCAGTGTGAATGGGGATGCTTCATGCACCGGGCTCCCCTTTTTTATACACTCAGTCAACCAAACATTTTAACCATATCATTATCAAATT
TTGAAGTAAGACTTCTCTTCTGCAATTTCATCAAAAAGCTCACCAGAAACTGGAAGGCCAACCTGCCAAGTGACAAAAATAGAGCAGGAATCATCTCAGT
TAACAAGTAGTGATGCTCACCCTTTTTAGTGCCTCTATGAACAACCATGCAACATCTGCACCATTATTCCTTAACACGGTTAGCAAATGCTTAATAACC[
G/T]CAGATACACTTGTCCCATGCATTGAAAGATGAGATAGTATCTCTGGAGCAAGATATTCCTGTAGATATTACAGTGATGAAATATGTTAGCACCTGA
AAAAGATAATCAACGGTATGCCTCCTAATCTTTGCTTTCTAAATGATACTGCAGTAATACAAAAAAAAGCATTGCCAAAATCCACATAAGAAGTACAGCT
AGGAATTAAGTATAGAAAAGTACAACTACGAAAAGAGAATACACCTAACCTTAGGAACTGCATCAACAGCAACCAACTTGCCAACAGCAATGATTACAGC
ATCT

chr06 35,102,133 C C T
TTCCACACGCCTGATCTTGT
GATCTGCGGTGTTGCCAAAA
20
20
20
59.69
89
AGAAGGACGTAAGAGGTTGGAAGATTTTTAAAATCTACTATTGTCTCTTTTGAATTCGTAGAATTACCCGAGTCTTCTCCAAAATGTATTTTCTCTTCTG
GTTTTATAGAATCCACTCTGTCAATAATATCGTACACGTCCTTTCCGGTTAATATCAGTAAGAGAAGAATCCCAAAGCTGTAGACATCAGTTTTTTGAGT
ACTAATACCTGAGGCTAAATTTTCTGGAGCTACATACCCCATTGTTCCACACGCCTGATCTTGTACCTCCAATTCCCCTGGAGGCAGTGATATGGAGAG[
C/T]GAGAAGTCTACTATTTTGGCAACACCGCAGATCTCATCAATTATCACTTTAGATGACTTTATATTTCTGTGGATGATTGGCGTAGTAAATTCAGTA
TGGAGGAAAACGACTGCAGAAGCGACATCACGTGCAACTCGTAATCTACTTCCCCAAGACAAGGACGATTTTCTATTAAGATTACCCTTTTTGAAAAGTA
GATCGCTAAGAGATATACCTTTAACATATTCATACACGATAACTGGCTCTTCAAACTCTAGACAGCAACCGATTAGTCTCAGCACATTCTTCAGATGACT
CATC

chr06 35,185,514 G G A
GCAAGATGCAATTACGTAGCA
GCAATCCTCGCAAAAAGGGG
21
20
21
60.11
135
CTGACTAAGTGTTACTGCTAGTTCTGAACATATACCACATAGTACACCTTATAGAGGCACATAAGTACCATTGGTTTATTACATCTTGCTAAATGAACAT
TTGGCCCCTTTAACCACAATAGGAAATGAAGAAAAATACAGCTCATTTCAACATGCTTCATAAGATTTTAAATGACACATAGTATTAAGTTCTTCCTAAA
TAAACAGATCAAATTCAAAAGATAACTGTTCAATCTTCACTATCTAGTGTCTTCCATGCTAATATAATGCAAGATGCAATTACGTAGCATAAGGATAAG[
G/A]TACGACAAAGCCAAATTTTTTCTAAGCTAATATGTATAGTCTCTAGATATGCAGGAATATAAAGCAGTGACATGCTTAAACATCCCCTTTTTGCGA
GGATTGCTTGACAATATTTTGGGTTAAGGTGAAGTCCCACTTTTATTGTGCTTCTACATTATTTTTATATATATATATATCGCTAGGATCGGAATCCTAC
AAATTTTTCTGATACTCAAATGTAAAGACCTAATGTAACACAGGATGGATTGCTCAAACTTAGTATTCATTTGATTACATAGATAAATATAAATCTGTTT
ATGA

chr06 35,701,469 G G T
CACGGAAAATAATCTCTTGTTGCA
TGACCACAATGACCTGCCAA
24
20
24
59.82
101
AGATTTGTATGAAAATAGTCTCCATTATTTAAATGTGTAACTGAATTTTTGATTTCCTTATATCCTAAAAAAGGTCATCTTCCTGTATTCTAGTCTTTAG
CCGCCTGATCTTAGATGAGAAAGTATATCACCTCCATAAGGCATACTTCTTTAATAGTAAAAGGTCATATCCTTGATAATATCAGTTATCAATTTTTGAC
AAATATATCACGGCTGATGCTAATTGCAGAGAGAGAAAAAGAAGCACGGAAAATAATCTCTTGTTGCAATATAATATAACATTTCTTCTTCATTGACAT[
G/T]GCGTTTAGAGTACATGATCAATGGTTTGGCAGGTCATTGTGGTCATAGGGGGTGCCACAAGTGCCTCTGACATCTCCAGAGAAATTGCTGAAGTTG
CTAAAGAGGTCCACATTTCTTCTAGATAAGCTCTAAGTAGGACTCCCAAAAAGGTGCATGGATATGAAAATCTATGTCTCCACTCTATTGTAAAGTTGTT
AATAACTTATGTAATTCTGTGGGGAATTGTCGATAATGCTGTATCTTCATGTTGCTAGAAATAACTTATACTGGCTAAATAATGCAGATTGAAGCTGTTG
GTAT

chr06 37,553,460 T T G
AAAGTCATCTGGGCCATGGG
CTGATAGGCCTGCTGCTTGT
20
20
20
60.11
89
GTTATGCATACGTGGGCTGGGTTGATGACACTGGTAACGGGAAAGTAAGCACATACTGGATAGATGGAAGAGATGCTTCCAATATTCACCCAACTCATGA
GAATTTGACACACGCAAGATGCAAGTCAGAGAATGGTATTATTACTATGGAATTCACCCGTCCACTACGTCCCTCTTGCGATCTGGACGATAAGCCAGAG
TGCAATAATATTGTTGATCCAACGACACCACTCAAAGTCATCTGGGCCATGGGTGCTCAATGGTCAGATGACCATCTGAGTGTGAGAAATATGCACTCC[
T/G]TCACAAGCAGCAGGCCTATCAGAGTGCTGCTCATGCGTGGTTCAGCAGAGGCAGAGGAGGATTTACGGCCAGTGTTAGCTGTACACGGGTTTATGA
TGTTTCTGGCTTGGGGAATATTGCTGCCAGGTGGTATTTTAGCTGCTAGATATTTGAAACATATCAAGGGAGATGGGTGGTTTCAGATTCATGTTTATCT
ACAGTATTCCGGATTATCGATTGTCTTCCTTGGTTTTCTCTTTGCTGTAGCCGAACTTCGCGGTTTGAGTTTCAGCTCCCTTCATGTTAAGTTTGGAATG
CTGG

chr06 37,817,774 A A G
TGGATATGTTTTATAAGGCCAGTG
CCAAACAAGCACTCACCTCG
24
20
24
59.41
81
CCTGCTGCTCCTCCAGCCCCCAAAGGACTATATCTATATGGCAATGTTGGGAGTGGTACTATTGCTTCTTTTCTAATTATGTTGCATGGTTGTTCATACA
TGCTGTACAAATTCATTTCATCCTCATTTTCTATAATGATGAAAATTTTCTTTTATTAGCTTCTATTAGCGATCAGCATCAGCCATTTTCTCACAGACAT
AAACAAAATCTGACTATATATTGGACCTCATTTAGGGAAGACAATGATTATGGATATGTTTTATAAGGCCAGTGAAGGCATTGTTAAACATCGAAGAAG[
A/G]TTTCACTTTCACGAGGTGAGTGCTTGTTTGGGCCTTATATTTTAACTTGATTTATAATATTCTACACATCAATCAATTGATCAAACTAGTTGGGGT
CAGCTATAAGCCCTATATATCCATTCCAGGCTCTGAGGACCCATTTCATTCCATACTAGTCCGGTTCTACATATGCATGACAAAATCATCTCGATTTCCT
GAAACAATTTAGTCTGTCCTATCCTGAATTTCTCTTCCTCAGAGTTGTGCTTCTAAGCAAAATGTCACAGGTCAAACAATTTGCAATGCAAGATTGTCTG
CCCA

chr06 41,201,668 T K T
ATGGACAAGGGTTTGGTTGC
CCGACGAGGGAAAGGAAAAC
20
20
20
58.85
80
GAATGGCAAAAACCCAAAACGGAAGAGGCAGATTGCTAAACTTAGCATAACAGTTCTTGTTTGGCAGGGTTTTTTTTCTATATTAAATCAGCTTAACAGT
TGGATTTAGCATTCATAGCTAGTTTGTTTGAGATTGAAGCATAATTGATCAAATAAACTAGCCTCTCATTAATTAGTACTAACATAAAGATGAATCGCAA
AAACGATCATTATTTTATCTGTATGTAAATTATCAAAATCAGAATTTTTTTTAGAATTATACCTTCTCAATGGACAAGGGTTTGGTTGCAGATCCTCTA[
T/G]AAACCAGAGACTCAAAATACCTCTCCACTGTTTTCCTTTCCCTCGTCGGTCTGGAACCTGGTGTTTTGGGCGAAATCGCATCATCACTTTTCGCTT
CCTCCTCTTTCTCTACACCCTCATCTTCTACCTTCTTCACAACTTTTTCCTTCGCCTTCTCATCTTCTTTGTCTACATCCATTTCTTCTGCGCCTTCATT
TTCCTCTTCGCTACTCCTCTTCGCCTTCGCCTCTTTCTCGATTGTTTCCTTCTCTTGCTTCTTCTCTTCTAGTGTTTCTTTGTCGGCCGCCATGGAAGTT
TTCA

chr07 1,958,146 A C A
TGCTCGACAATCACCAGCAT
TCATCTCATTACGCTAAGAGTAG
20
23
20
55.19
108
CAGCAGTTTCAGTTCAGGTTCAGCGCTCAATGGTCCGCCCTTCTCAACTTCCTTCAATCCTTTAATATGCCAGTTACCTAAAGCCCGGCTCACGCCTAGC
TGTCCATTCAAATAGCCATCATCAACAAATCCACCTACTGACTCGATGCGAGTTCTTTCAGTAACACAACAAGGTCTGTGGTCCCTTGACATTTCTATAG
CCAGTCCACGTCGAGATACAACTGCTCGACAATCACCAGCATTGGCCACAAGAAGTGATCTGTTCATATGATACAACACATCAGTAAAAAGATTTTGAT[
A/C]AAAGTGGCTACTCTTAGCGTAATGAGATGACTTAGGTACAGGAATAACTTACCTTCCAAATATCATTGCAGTGAGTGCAGTAGTGCCGGAGGACAA
GGCTGAGTCAACATAGCATGACTTGGCAAAGGCAGCATCCGTCTCTGCAAAAGATCTTGTGACCACTTTCTCAAGTTCCAGGGGAAAATCAGCATCCTCG
ACAATGATCTTTGGTAAGTAATCACGAACAAACTGTGATGCTCCTTTCCCTCCATGTCCATCAAAGACCTGTCATTAGAACCATTAGCATTAGGCATCAT
CAGA

chr07 55,930,382 T G T
ACCAGAATGGGAAGTTCGGA
GATCCCGTACATCTCCCCAG
20
20
20
59.03
89
GGTTATGCATTTAACCGGACAGTGTGGAGGAAAATTCATAATAAGGCAGCAGGATTTTGCACTTTTGATGATTACAATTGGGATATAACAATGTGGTCGA
CAGTTTATCCTTCATTTGGTTCTCCAGTTTACACATTACGTGGGTCTAGGACCAGTGCCGTTCATTTTGGGAAATGTGGTTTGCATCAAGGTCATAGTCG
TAATCTAGCTTGTATGGACAATGGCAATGTGAATATTGTTGTCGATGAACTTGATAAAGTGGCAAATATCAAACCAGAATGGGAAGTTCGGAAATATGA[
T/G]CACCAGGCAGGATATCAGGCTGGTTTCAAGGGATGGGGAGGCTGGGGAGATGTACGGGATCACGAATTGTGTGTGGAGTTTGCTAAAATGTATGTC
TGAGGGTGGTCTTGCACTTTCTGAAGAGTGATATTTTGAGCTTCACAACCATACTACTTTTAAGGTCTGGAAACCATGGAAATCACTCTTTAGTGTAAAA
CATGTGTAAAGTTTTAGGAATGACGTTATGTTTTGCATTCACAGGCCAGCTATTATTGAGTGCACACTAAATTTTGTTTTGCATCCCCTTTCTGGATAGT
GGTG

chr07 60,573,579 C T C
CTGAAGGGTTTAAGTCTGATGAGA
CCTGGGTTCAAACACACAAGC
24
21
24
60.2
92
GTTCTGTACACGCGCAACCCGTTAATCCTAAGGATCTTGCCTCCGTTATGGCCAAACCTCAAGGAAATCAAGCTTGTTCGATGGCATCAACGTCCGCAAT
TATCAGCTGGGGAGGAGCTCAGTATGCTATTTACAGAGAATTGCCCAAAGCTTCATTCGCTAGATTTGTCCAATTTTTACTGCTGGACCGATGATATTCC
TGTTGCACTTGAATCTCATCCTACAGTTGCAGCTAATCTCACGAGCTTAAATCTCTTGAATTCGAGTTTTTCTGAAGGGTTTAAGTCTGATGAGATTAG[
C/T]TCGATAACGCGAGCTTGCCCCAATTTGAAGGAGTTTCGTGTTGCTTGTGTGTTTGAACCCAGGTACTTTGGGTTTGTTGGTGATGAAGATTTGGTT
TCCATAGCTAATAATTGTCCTAAATTATCAGTGCTTCATTTGGCTGATACTTCAGCTTTATCAGACGCTAGGGGTGATCGAAATGATGAGGGGTTCACTC
AAGAGGACGCGAAGTTTAGTGCTTCAACTTTGATTGAGGTATTTTCTGGTCTTCCACTACTTGAAGAGTTTGTTTTGGATGTTTGTAATAATGTTAGGGA
CACC

chr07 62,455,841 G A G
GTGGTCCTAGCCATCTTGCT
GGGTGGCAGAAGTGAAACGT
20
20
20
60.82
150
ATCTGGATGCTGCTCCTGCTGCTATTGCACGTCTTTTTTCAATTGAGTGGTACAAAAACCGCATTAATGGGAAGCAAGAAGTCATGATTGGCTACTCAGA
CTCTGGAAAGGATGCTGGTCGGCTGTCGGCAGCATGGCAGCTATATAAGGCTCAAGAGGAGCTTATAAAAGTTGCCAAACAATATGACGTGAAGCTAATT
ATGTTCCATGGCAGAGGTGGTACAGTTGGAAGAGGAGGTGGTCCTAGCCATCTTGCTATATTATCTCAGCCACCTGATACGATTCAGGGATCTCTTCGC[
G/A]TAACAGTTCAAGGTGAGGTTATTGAGCAATCATTTGGGGAGGAACACTTGTGTTTTAGGACACTCCAACGTTTCACTTCTGCCACCCTAGAACATG
GAATGTATCCACCTTTCCCCCCAAAGCCAGAATGGCGTGCACTTCTGGATGAAATTTCTGTTGTTGCTACAGAGAAGTATAGGTCAATAGTATTCAAGGA
ACCCCGATTTGTCGAGTACTTCCGCCTGGTCAGTGTGCTAGGAAAATGCAATATATTACTTATCTAACAATAGGTGTTACCAAAAGGTAACAAATATTTC
TACA

chr08 37,792,547 G A G
ACCTGATCTTTATTTGGGATTGAG
GGTGATTTACCTACTATGGTGTAT
24
24
24
55.49
80
CTTCTCTTGGTTGAGATACTGCTGTAATTTGTTGAGTTTTCGAGCTTACAACATCCTTCCTAGCTTCGCCTTTTCATAACTCACCCCTGCGTTGCATATC
CGAATTGTATTACCCATGGTTTCCCATAGGATGGTAATCTTGATATATTATATTTGATATGTTTGTGGCATTAACCTGTTGATTGTTAGAATCGATTTCA
TTTCCTTCCCCCATTAACAGCTTTCATTCGACTAGCCTTTGAGTCACCGACATTCTTGTCGCGGACAACCTGATCTTTATTTGGGATTGAGATTGTAGT[
G/A]AGAGGTATGCCTTCTCCATGGTAATACACCATAGTAGGTAAATCACCACGATTCAACTTGGAAGTTAGTCGATTTTGAGCTCGAGTTTCATGAAGG
TCCTTCGCGACTTCCCCTGAAATTGAAAACTCGATTCTCTCAAATAGCAAAGTATGTTGTTACCATTGATTAGAAGAAATATTCCCAATATTCCTATCAT
CTTGAATTAACCTTATAGATTCAGGGGAAATAATTTAGCGATTCCCTGCCATTTCACTCTCGGAACTCTCACTTTTCATCGCTTCAATCAATGCCAAATT
CCCA

chr08 58,454,935 T Y T
TGCTCTGCAGGATTACATGA
TGTCCTCTTGTGATGGATCGC
20
21
20
60.13
80
AGGGAGCACAGGCTGGTTTTCCAGGAAATTATTTGAACCGGAATTCACAAGCTGGATACTCACGTTTTGGTTCAGGAAATGAATTTATGTCACAGGTAAG
CTGTCCGGCCCCTTGGCCCCTTCATTTCTTGCTCTATTAAGTTTGTGGGGGGGGGGTTTGGAAGAGGTCGCAGTCTCTTCATAGGTGGTGAACAACTGTT
ATCTAATGTGGTTTTCTTTGCTGATGTTTGTCTTCTTCCTGTTTACGTAGGTCTAATGCTTATGTAATCATTTTGATTGCTCTGCAGGATTACATGACT[
T/C]ATGGATCCCAAGGTCTCTTCACACAAGCTGGATACAGCGATCCATCACAAGAGGACAGTTCACAAAACCATTTTGGCATGTCCAATGCAAATCCAC
TTCACTCTCAGGTTACTGCATCATAATTCTGCTTGGTAGTTAACAAGATCATTGAAAGACTTCCAAATATGAAATATGCACATCACGTGAAGTCTCTAGC
TACTGGGAAGTTCATTCTTCACCAGTATCAAGATTTAGGGGACTTCCCGTGTTGCAAAATGATCTTTTTATTGGTTAGTTCACCAGTCTAATTAATGGCA
ATAT

chr08 61,325,583 A A G
AGAGCTCATCAAGGTGCCTC
GTGTGTTGCAGTTGCTAGCA
20
20
20
59.34
80
ACAAATATCACATACAAAGTCAGGTTGATGGCAGCCCAATGTAGACCACCTTCTGATACACTTCTTGCCCTGCATTTTAGTTTACATTTTTCTATATCCT
ATTTGAATATTATTAAGCGCGACTACTGTACATTGGGGAGATGTTACCAGAAACCATCATCGACGGCCACTGCAGATGGAGGATAAGGATCATCCTCTTC
TTCCATTTCCAATTCTGGTTCAGGAGATCCAAATTCAGTCAGCTCAACAGCAGCAAGGTTCTTTAGGTCAACGATCGAGAGCTCATCAAGGTGCCTCAC[
A/G]ACCAAGTCAGCAGCACCAAGCTCATACACTGGATGTTTGCTAGCAACTGCAACACACTTCATCTGAGCATCATGTGCAGCCTCGACGGTTTGGTTT
GAGTTCCCAAACACAATACACCTCTCTGGTATGAATTGTAGAAGCTGTGATGCATAGACAAACATCTCCGGATCAGGCTTCCCTCTGTGAACATCCTCTG
CAGCTACAATTACACTAAATATCCCTTCAAAGCCAATGGTACCAATTGCATTCTCGACATATTTTCTTGGACGTGTAGACACTAAAGCCATTGGCACTTT
GTAG

chr08 61,562,859 T C T
TAGGGCTGACTTGGACAAGA
CCATATCTTTCCTCAGCTTTTCCA
20
24
20
58.8
92
GCAGACAATACTTACACATCAACTCTGACTCGGAGCCTCTCTCTTGCACTTGAGGAGTTCTACAAGAATCTAAGATCAGTTGGAGTCTCTGCAGTTTCAG
GTGCTGGGATGGATGCCTTTTTCAAGGCAATTGAAGCCAGTGCTGAAGAGTATATGGAAACTTACAAGTATTACAGTAACTGAAACTTAGTGTTAATACT
TCTTGAAATACCACTGATAATTGGACATGCTAAAAAACTGTCATGTCCACTTTCTTATTATTGCAAACTTTTCTTTGTAGGGCTGACTTGGACAAGAGA[
T/C]GGGAGGAGAAGCAGCTATTAGAGGAAACACGCAGAAGAGAAAATATGGAAAAGCTGAGGAAAGATATGGAGAAAACCGGAGGTGAAACTGTAGTAT
TGAGCACCGGTTTGAAGGATGTAAAAGGGAAGAACAAGGGTATGATGGATGACGAGGATGAAGAAGAAGAGGAAGAGGACATCAAGGTATTTAGTGACGA
TGAAGATACCATAGACGAGGATGAAGATGAAGATGCTGGCTTTCCAATCTGAGCCTGTACATGGTGTCCTTTTAAGAAAATTTACTATGTATAGGACTGA
TCAA

chr09 526,213 G A G
GCAGACACACCTGGTAACGT
ACCACCTAGACTGCACCTAC
20
20
20
58.44
137
GACCAAGATACGAAAGGCGGCTACTGTTTGACCGTATAAACCTGGGTCTACTGGAGATTGTTAGGAAGTATGTGGATCCTTGCCCTTGGGTGAAGCCAAT
AGAGGGTATTATCTGGAGATGGGAGACTTATGGGATGAAAAACATTCTGCATCAACTGCTGAGAAGCCACGAAGATCCTGCAAACGCAGACACACCTGGT
AACGTTGTGGAAGAGATGCATTGGCTAGCAATCAAGGATGAAATGGATGTGGCAGTTAAGGACATTGAAGAATTGTTGATAGATGACCTCATAGAAGAA[
G/A]TTGTAGGTGCAGTCTAGGTGGTAGTTCATACTCGACGATAACGAAAGATGGAAGGGTTTAGGAGATATAACTAATAAAAATACAAATGTTGCATTA
CCTTAGTAATAACTATATAGTTTAGCTTGATGACATTAAAATGCCAGTATCTGGCAATGACATTATATGAAATATTTCTGCGAGTAGAGAGCAAAGTGCA
TTCGCTTGTTCAAGTTCAATTTGAATCTGTTTTTACCTTCATGTTTTGTAGTCTCTATGGTTGTGAAGCGATTCAGTGAGGCTATGAATCGATTGAACCT
ATCA

chr09 2,082,883 G G T
TGTTGAACGTCAATGCTGCA
TTTTACCGTGCTTTTGACCT
20
20
20
55.79
81
ACTCTTGAAATTTAATTTCTCCACCAACAAAGCTTATAGAGACTAAACTTGACTTTGATGAATCAAGCACGACTACTTTGTCACTTGTAGGCAATGACAA
ATCACCAGAAAATCCACCAGCAAACCCCTTGCTACTGTGCTTCAGCAGCTCCCCATTTCGAACATTGATTACATATGCTTCAAACTGGGATGCCTCACCA
ATTCCTAAAGCATATATTGTGTCACTTTCTTCAGGATGAACCAAATGTTGAACGTCAATGCTGCAATTTGAGAAACTACAGATTAAATGGACCTTTTCA[
G/T]AAATTTAGGTCAAAAGCACGGTAAAATAGTTTTATAAGGTTCCCTAACCTGTTCTCTGCTAACTCTTTCTTCCAGAGGATGTCACCATCAATGCTT
GAAACAGCATGCAGGCAACCATTGCCATAGGCCAGAATAACATTGTCCTTGTCAGCTCCGAAGTTTGTCTGGAAAGAGAAAATAACAAATTTGTATATCA
GTCTCACTGACTTCTCAGTTTCTTCATTGACATGACAAATGACATTTTCTACAAGTATGTTAGGAAATTACTTAACTTAAAATCATCTCTAAGTTGAAAC
ATAC

chr09 2,417,881 A A G
CTATTCAGCCACCGGGAAGA
TGCATGTGCTTCACGTATGC
20
20
20
59.55
101
ATTAATGTAATATAGCACATAAGAGAGGAGCCCTTTTGAAAACAATGCAAAGTAACCGGTTCCTATCTGTAAGCTGATTAATTAGAGAACTCATGATTGT
AAGGAACACTTCTGCATAGCTAAGCTGGACTGAGCAAGTCCCAGGTTCCAATCTCAGTAGTAGTTGCACTGCAGTAGTAGAGGGTAATTGCGCTAAATAG
GTCAAGCTTTTCATCAGTCTCTCTATAGATTAATACTCCCTTATGTACCAAACCCGTATCAGGTGAAACTTCGGATTCTATTCAGCCACCGGGAAGACA[
A/G]TGCAACTCCCAAGAAACTGGTAGACTATGTGATGATGAAACATGTTTTGCATGCAACAGCATACGTGAAGCACATGCACAAACTGTGAGAGGGACA
ATTCTGGTAAGAGAAGAGAACAAACTGTTTTAGTGTATGTCATGGGAAAGTGATACGATAATCCTGATCATCTCTGAATATACTTTCTAACAGATACCAT
GTAGAACAGCTATGAGAGGTAGCTTTCCGCTCAATGGTACATACTTCCAGGTTAACGAGGTGAATACAACCAACGTTTCCTCAACTCGAGCGAGCATTTT
TTGC

chr09 61,260,712 T C T
TGCGATGTCATCAACCATGA
ATGCCAGGATTTATTTGGCT
20
20
20
55.32
92
TGCTTTTGAAGAACCATCCAATCCTCTACTTTTTTTGTATAATTTCCGTATCTCCATTTATCAACATCCATTACCAACACCCCCGTGTTGAAATAACACG
GTTTTCGCCCTTCAAATGTTCTTGGCATATAAGGATCAGACCAAAACGCTTCAGTAAAATAAACGGTGAAATTTGCTTGACAATATTCAGGTGCAGCCAA
AACCTTGTCACCTAATTCAACCTTCCATAACTTTGCGATGTCATCAACCATGACAAGGTCAGAATCAAGATAAATAACGCGTTTCACCTCATTAGGTAT[
T/C]AAATTAGCCAAATAAATCCTGGCATAATTCAACGGTTGATCTAAAGCTTGACGTATAGACTTAGATATTAGGCCACGTACCCTATGTACATCAAAT
CGATACACCTTGAAATTAAGGTAAGGAAACGTTGCCTTAATACTCGAAAACACCTCATGTTCATGTCTAACCCATAGGAAATGAAAGGTAACGTCTTCAG
GGCACGTTGAATGTTGTAATATCGATAACACTGCAGCCATAGTACCTCTTAAATAATTAGCATCAAGTGTCATAGCCACATGCATTCTATCATTATTACC
ACAA

chr09 63,185,282 C T C
TTCACAGATAACGAAGAGGATGA
AAGATGCCATCGTCTTCTCTCC
23
22
23
59.9
80
ACAGTATCTCACAGACTATCTGCGAGGGAGCTTCTCGATGACCCTTTTCTCCAAGTTGATGATTACGTGTCAGACTCAGAGACACCAAATTATTTGCAAG
ACTCTAATGAATTTGACGTTACCTTAGGGCATCGACCCTCGAGCATATGTGATAACAACTCTCTAGTAAATGGATGTCTTGGTTATCTTGGATATGAACC
AGAGGATGATTCGTACTACCATCAACTTGAGTATGAGGCAAATGAAATTGATTTATTCACAGATAACGAAGAGGATGATATGGAAAATGCTGATATCAG[
C/T]ATCAAGGGAAGGAGGAGAGAAGACGATGGCATCTTTTTACGACTCAGGATAGCAGATAAAGAAGGTTTTGCTTTATTATTGCTTCATATATATCAA
GTAGTGTTCAGTAGTCTTGCTGTTAACTAAATTGCTGTGCATTTACATTCACAGGCCGTATCCGCAACATTTATTTTCCTTTTGACATTGAGAATGACAC
AGCACTAACTGTCGCTACTGAAATGGTGGCCGAGTTGGATATTACAGAACAAGATGTTACCAAGATAGCAGACATGATAGATGGTGAGATTGCTTCCTTA
GTGC

chr09 63,455,142 G A G
ACACGTTCGTGCAATCGTTG
TGGCAAATCAAGGGAGCAAGA
20
21
20
60.2
99
TACGCGAACACATTAAGGCTATTAACAAGAAGATTGATTTTCATTTCTTACCATTGCATTGGCTAAGAGGTGGAGTTTGAACATTACAAGCAGTAGGAAG
TGCCAAGGCCTGAGTTTGGTTAATATTTAGCCCCAAATTAGAAGCACCACCATTTAGGACTTGACACAAACAACTTGGATTGTTGTTAACCACAGTGGCA
AGTTGAGTGCAACAACCTGAAGTTGGAACAGAGGAATTGCCAGTAATATAGTTCAAGCAAGGTGACATACTAATCAACACGTTCGTGCAATCGTTGCTC[
G/A]ATTGAGCAACAACTCCAGAACAGATCATCGCAAACATAATCGCGAAAAAACTCATCTTGCTCCCTTGATTTGCCATTTGATATGATTAGATTTTTA
TTTTTTTTAATTGATGTTTGATCACACAAATGTTGTTTGAATAAGAAATGTTGTGTTTGTTTATATAGGAAAAAAGTTGAGTAGGGAGAGTCAAAAGAAG
ATGTTTTTTTTAAAAATTGGTGACCGATAAACAAATAGTAACAATTTGACATTATTTTGTTTTATTATATAGTTTACACAGGAATTAGGTAGATTTGGGA
CAAA

chr10 4,634,227 C C T
TGCACTTTCTTGGACAAAACA
TGACCAAAGTTTCCCGGCTT
21
20
21
60.11
134
TTCCTAAATGGAGACATGAGAAATGTGAAAGTGACTCGAAATGGTTGGGTACTCAAATATGGCCTCTAGACAAACAAGAACAGAAAAGAATGTTAATTGA
AAGAGATCCTATTGGAAAAGGAAGGCAAGATACATGTGGCTGCCAATACCCTGCTTCTTATGAATGCATCAGGTTTCATCTCGCTGAGAAACGAAGGAAG
GTTAAACTTGAGTTGGGATCAGCCTTTTGTCGGTGGAAATTTGATTTGATGGGCGAAGACGTTGCACTTTCTTGGACAAAACAAGAAGAACAGAAATTC[
C/T]AGGATATAGTAAAAATGAACCCTTTGTCGACAGACAAGAGTTTTTGGAATGAGATATTCAAATTCTTTCCTAACAAAAGCCGGGAAACTTTGGTCA
GCTACCACTTCAATGTCTTCCTTTTACGGTGTAGAGGTCATCAGAACCGGACTGCTGCAAGTACTATCGACAGTGATGATGATGAACCACAGTACGGACC
TAGAACTAATTGTTTCGGTAGGGATCCTCAATTCTCCATCTTTTGTTCCCCGAGGAAAGCACATCTGGATCCCAGATAGTAGTTGAATGTTTATATTCCA
CGAC

chr10 60,090,996 A G A
CCTCTTTTCCGACCACCCTC
CTGTGAATAGTATCGATGGAGTCA
20
24
20
57.68
114
TTAGCTTGCCGCTAACAGCAAAGATGATTGATGCTTTCTTGCTCGTCTGAACTGCATTGTCTTCTTAATTTTGGGCTCAGAGCACGGGCCAACAGCAAAG
TATACATAACTGAGTGTGTTTATTTTCAAGTGAATATCAATCTGCAGCCTCTCGCAAGATCTGAAAAGCCACAGTCGAACAGCACAGAAACACATACAGT
TGTTGATGGCAATGATCGCCAGGAGAAGCAAGAGCTCTGTACATCTCTTGCATGAAGTCCTCTTTTCCGACCACCCTCTTCCCTGCTCATACACCCAGC[
A/G]GCAGACCTATGTAGATGTGTACATGAAATGGAAGAAAGACTCTTTTTTTGACTCCATCGATACTATTCACAGATCAGTTCAACTCAAGCCCTTAAT
TGCTCTTAAGAACTGCATAGTCTCCTCTTCACCTAATGATTATTGCATCCCCATTTCTGTTATTTCGAAAAAAGGCTTAGAGTTAGGGATACCCATTAAG
GTTGCCAGGTTCTTAAGGCTGTATCCATCTGTTTTTGAGGAATTTACTGGCCCTAACTACAATTTGCCTTGGTTTAAGTTGACCCAGAGGGCTATTGAGC
TTGA

chr10 62,499,936 C T C
CCCAAGGCTAGAAGATGTACCA
GGAACAGATGCCTTTCAGGGA
22
21
22
60
90
TTTTGTTTGGATTTGGTCAAAGAAAAACAAGGAGATATATTGAGCTGTAGCAGAAAACTTTATTTAACCAAATGGAAGACAATGCTATATACAGTGAAGA
ATAGTAAAGAATCATTACTTGGTAATTCAAGAGTAAGACAAGACTGGAGCCACTGAACGCGACATCAGATTCCCTCTAGGTACGCGATATATACTTTCAT
TCATCCATCATGCCTATAAATCTTACCATAAGACTTACGCGCTGATAACCAAATATTCATACCCAAGGCTAGAAGATGTACCATCATCACCATCAAGCT[
C/T]CCAACATGCACCCTTCAACAAGAATGTCTTTCCCTGAAAGGCATCTGTTCCTACAAGGTGGGAATGCCAATGGAGACTCAGGGCTTGTTCTTTCAA
CGGATGCTAAACCAAGATTGAAATGGACACCAGACCTCCATGAGAGGTTTATAGAAGCAGTTACACAACTTGGTGGGGCAGACAGTAAGTGCACATAAAT
ATGTTAATTTGAATAAGCACCAGATGTATGTTGCTTATGACTGAGATATTAAATATCCACCATTCTTCTATTGCAGAAGCCACACCAAAATCAGTTCTGA
AACT

chr11 4,155,877 C T C
ACATCAATGAAACAAAGAACTGGG
GGTTGAGTTAGACCCAATGTCCA
24
23
24
60.24
80
TTCCTTTTTCACAGCGGCATCAACTGAAGACCTGCACATGTTACCACCAATATTAAATGCAAAATATACGCCACTTTTTTCAGAAAATTTTGTAAGGATT
GATAAAGAAATGAATATTGGGTCAAACTCAACCCTAAAAATTAGTTCATTGCCAAGCCATATAAAGAGATCAATTCCCCAATCCCTAGGCCAATGTGGGA
GACTCGACAACCCCACCTGCCAACCAGAGCATGAACAATACAAATGGGGGCCCAACATCAATGAAACAAAGAACTGGGATGGGTTCGACACTAATATCA[
C/T]GATAAAGAAAATGGACATTGGGTCTAACTCAACCCCAAAAGCTAACTCAAGAGATGAGAATTGCTCACTCCATATTAAGAGAGCAAGTCCCCCGCC
TCTTAGCCGATGCGGGAGACTCAACAAGGATGACTAAATCGAAAGACTTTCTGTGGAAAAAGTTTTGAAACATTTTCCCAACTAATGAAGAAAAGAAACA
AGAGGACTAATGAAGAAAAGAAGCAAGAGGTACCACCAAGCTATAACCACCAAAGCAATTGTGGCAAAAACTAAAAATTATACAATAATCTAAATTGATG
TATA

chr11 5,788,117 G G A
GGCCTCAAAGAAAAACTCAATGC
CCTACAACCTGTAATTGAACGTCG
23
24
23
59.91
80
ATTTGGTAGGCCGTAAAATTCACAATCTTTTTGGGTTGGGGGTTGAAGGACTGAGAAGAAGCAAAAGCAGCAATGGCAGCTGGACTTGCAATCGGATTTA
GTGCTGTAAGGCCACCATTAAAGCAAGCACTAGGAGTGAAAATCCTCAACTACCAAAAGAGCAAATGGGTCTTTAGCCCTTTAGCTTTTTCGTCTTCTTC
TTCTTCTTCTTCTTCAACATCAAGAAAGCTAATACTCTATTCAAAGCCTGGTTGCTGTTTGTGTGATGGCCTCAAAGAAAAACTCAATGCTGCTTTCTC[
G/A]CTTTCCAGTCCCCATTCTCTACACGACGTTCAATTACAGGTTGTAGGACCAATTTTTTGCTGTATATCAAATTTACGCTGTGTTTTTATTTGAAGT
TTGATTTAATGGGTTTTTACAGGTTAGAGATATAACTAGCAATCCTGATTGGGAGAAGGCTTATCAATATGAAATACCTGTGTTGGCTAGAGTGCGTCCT
GATGGCACTGAGGTTAGATTAGCATTTTGTTGTTGTATGCTACTGTTTTGGAATATGGTAAATTTTTATCATCTTGCAACTCATTGTAACTAATTTAATT
TTGG

chr11 8,160,508 T T C
GCCGTAAATTCTGCAGGCAC
GTGCTGGGCTCCTAAGTGAA
20
20
20
59.68
113
TTTCATTTCAAGTGGATTAATGTCCAACAATGAACTCGTGCACATTTCCATTGATATTAATTGAACTGCATCCAGGTGACTTCTTAACACCTAAATCCCT
CATAGTTCCTCTGACCTTTGATGCATCTTCCCATCTGCCAGAAGATGCATAGGTGTTCGCCAGAAGTGTATGAGTGCTAGAATCATAAGATTCAATCTCC
ATGAGCAGTTCAGCCACACGTTCACCAACATCAACATTGCCGTAAATTCTGCAGGCACTGAGCAAAGCCCCGTATATTGGAACTATAATCTTATTGTCT[
T/C]TATTGGGTATCTGAGATATCATTACTTCAGCTTCACTTAGGAGCCCAGCACGACCAAGTAGGTCTATCAAACAACCATAATGTTCTAACTTTGGCT
GAATCGCATGAATCCTACTCATTGCATGGAAATACTTGCGGCCTTCTTCTACCAAGCCCCCATGGCTACATGCACTTAACACTCCAATATAAGTGATATC
ATCAGGGTGAAATCCAGCCTGTTCCATTTCTGAGAACAGTTCCAGTGCCTTCCTAGTGTTCCCGCTCATGGCTAGAGCACAAATAATTGAAGTCCAAGAT
GCAG

chr11 14,406,213 T T C
CCAGATCATCATCTTCACGAGC
TGGTTATTTTCCTCACTGGCT
22
21
22
57.19
93
TACCCTATGTATAACATTCCAATAATAGCAAATATGATCACAAGGAGAACAAGTGTTGTAAGCTGAGCACCAGTGCCAACAACAGCTGAAAGAAGGGCCA
AATTTTGTGGAGGTCGGAAAACATCACCATGGACAAGTTTCCAACCAGACTCTTCATTCACATCCCTCTCCTGTACAATTGTTTATTTATAAACCATAAA
AAATATGTAACTGACGAATACATGATTCATTGAGAAAAAAAAAAGATTACCAGACTCTCCAGATCATCATCTTCACGAGCATATTTAGCATAATCATTA[
T/C]GAAGAGTGCGCATCAAAATCATAGACACTAAGCCAGTGAGGAAAATAACCATCATGAAAGAATTGAACACCGAGAACCAGTGGATCTGCATAAAGA
ATAAGATGTTAACAGAGGCTGGCAACAGAAAGAGAAACTCATAATTACTTGTTTTTATATGCAGCTTTCTCTTTGACTCATTGGTTTCAACAAGGAACAG
AAGAACATGAAGTTTCAAAACATATGTGACAAGTAAGCTCAAAAGGACGCTATCCAAGCAGTTGAATTCTAAACTTTTTTGGGGGCAACAAGGTATTGTC
TCTA

chr11 19,646,636 A A G
AGGCATAGCTTGTTGTTCCT
TTCAGGAGATGGGTTGCTCC
20
20
20
59.38
95
AGGAGTGATTAGTAGTGCCCATTTTTCGCAATTTACGTTCGTATGCCATTATGATTCTCTCATAATGATTAATGATAACTTGATCAGTCGTTGACACAAT
GACACACCTTGCACTTAAGCAAGTGTGTACGTGTCAAGGTATAACTGATATTTCTTCCTTCCCCTACAGTGATGGATTGTTAGATTGTAATTTTTTTCCC
TAATTGATGCTTCTCATAGTATTTTTATGAATACATTAGATTTAATAGCATCTTGATTAGGCATAGCTTGTTGTTCCTTTCTCTAATGTGGATTATACT[
A/G]AAGGGAAGGGCCCAGAAGAAGATAACTTAAAAGGGAGCAACCCATCTCCTGAAAACGATAGCTCAAAAAATACTGGATCTCCGAAAGCTCATCAGA
AGCCCTTGGACTGGAGGGAATTCCGAGCATCTCTTTACATTCAGGAGCTGGTATGGTTTATGGATTACTTCCGCAAGTGTGTAAATCATCTTATAATCTG
ATAAGTCACCTCACTTTCCTTTTCACATGATGATATTACATGTTGATAATCATTTCTTAATGTGTGTCAATGACATGATTCACCATGTCTTTTTTTTGAG
GTGT

chr11 27,448,927 T T G
GGATACCAGTTAAAACCTCAGTGA
CCAACACAGACTTTGCCTTT
24
20
24
56.74
81
TGGTTCATCTTGGGTAGCGTCCTACTAGTCAAGTGTTGGGAGCCAAATTTTGCACTAAAGGAATCAACAATCACTCACTCCCCAATCTGGGTTAGGCTAC
ATCAATTGCCCACTAAACTTTAGGACAAGAGCATCCTAGGAAAAATAGGAAAAAAACATGGGGCTCTCCTTAAAATCGATGTCTGCACATTTGCCACTCT
AAGAGGACCGTATGTAAAAATATGCATAGAGGTGTCGATAGGGATACCAGTTAAAACCTCAGTGATGATAAAGGGCCATAATCAAGATGTTCTCTATGA[
T/G]GCAAAGGCAAAGTCTGTGTTGGCTGTGGAAGAATTGGGCACATCATCACTACATGCACCAACTCAAAGACGCTCCACAGTAGGACACGAACACAAA
GTGAGAACATTAATAGCGCACCAAAGGCGAGGTTTGGAAGATTGTGGTCTTCCCTAAGAGGAAAGGGATACGACCACCAAAACTGACGGCACAACACAAG
CAATCGGCCTAGAACGTACAACCAAAACCCAAGTAATAGTTCAAATAGAGCTGAAAGGTAAGTCCCCTATCTCAAAAATTCCCCACTCACCCCCCTTCAC
TAAC

chr11 28,386,747 A A G
CTCTGGGCTGCTTCTGCTCG
GGATGATGGTGAAATGTATGACGA
20
24
20
58.94
84
GCACTCCGTTATGAAATCTTTTAAAGCTCAGGACTAAAGCAGCTCATCGATCCCAAAACAGGATGACTAGGATCAATCTAAGCAATCTAGTAGATCTAGT
GTCTACTAGATGAAACAGTTCGACTCACTAGATATTGCATTTAAGAGAAATAATGCAAGATGCATAAAACCATAAATTCTGCATTATGGACAACACATGT
AACAAAACTATTGTCCTCACCTAATTCCTCAGCTTCCCATCCAGCGCGTCCTACTCCAGGGGGGAGGCTCTGGGCTGCTTCTGCTCGCTGTGTTTTAGC[
A/G]CGAAACTTCTTCTTCAGATTTCCAAACTCGTCATACATTTCACCATCATCCTATAATTGAGATGAAGATTTCACCAGAAAGTCAGAAGCAGAATGA
TACCCAGGATAAGCTATAGAACTCATAAACTTCTGCAATTTTTATCTTACTTCTTCAGCCTCTCTCCTCCGACGTCTAGTTTCCTCTATTTCTTCTTCAT
CGAGTTCTTTATAACCTCCAGCACGTCCTCCTCTGAAGAGTACAATAAAAGTAGATCATAGTTAATACCTAAGAGAAACACTATTTAATACATCAAATTA
AACT

chr11 28,585,137 G G A
TCTGCAGTTAATAAATGCAGCCT
GATTGTGGTGCATCTGCCAG
23
20
23
59.55
95
CAGGGAACACTTAGGGAATGGGTAACTAGAGATGAAGTCCGGCGCTTCATTGCGAAGAAATTCAAGGAATTCTTACTCACATATGTAAATCCCAAAAATG
AACATGGGGACTTTGAATATCTTCGACAGATTAATGAGATGGTATCAGGTAAATACGTTTCTGAACTTGTCAAGTCATCGCTGACCTTTTCAAGAATGAA
TTAAGTTTTATGAGTTCCAACAGAGATCTTTTATTAATTTAGATCTTCTGTTCATCATTCATCTGCAGTTAATAAATGCAGCCTTGAGATTGATTACAA[
G/A]CAATTCATATATGTCCATCCCAATATTGCCATCTGGCTGGCAGATGCACCACAATCCGTTCTTGAAGTGATGGAAGAAGTTGCCAACAAAGTTGTC
TTTGATCTTCATCCCAACTATAAGCAAATTCATCAGAAAGTCTATGTCAGGATTACCAACTTACCAGTTTATGATCAGATTCGTAATATAAGGTAATATC
ACTTGCTTACTTTGGCTTGACTACAGCTAGTGTAAATGAAACCTCACTTGAAGTTGTCATTCTTTGCAGGCAGATCCATTTGAACACCATGATTCGTATT
GGTG

chr11 35,248,662 T T C
TGTACACATGACACCAGTCCA
TGCCTCACAGAACTGTATGCA
21
21
21
59.65
85
CTTCTAATATAATGTCATTGAAGTCCTTTATTTCTTTATTTTCTTGACCGCTTAAAAAATATCATGAGTACGCTACTGGGGAGGCGAATGATGGATACCA
AGTAAATGTTTGTATCGACTAGCTAAGCGCAGCATCGCATAACCACACTTGCAGCGCGAGTTGTATTATTACTGTTTGACTATTGCCAGCACTGCAGTTC
AAGAATTTGCTAGCAGTGCCAATTTCAAGTACAATACTGCTCTACTGTTAGGTTGGTGTCATGATGTACACATGACACCAGTCCATTTCTTGATGGAAG[
T/C]CTTCCCATTTATATGCTGCAAGTTAAGTTGCATACAGTTCTGTGAGGCACCTAGGTGTACGTTTCAACAACTAGTTTAGCCTAATAACCACGACAC
CAGTTTGGCATGCAGTTACATTTGCATTTTTTGCTACTATTTGCATACATTTTTTTCTTACACTTATTCCAAACAATTAGGAACAGATCAATAAAGCTTT
ATTGGTCTTAGATGACGCACCCCCACCTCATGTTTAAATGCAGAGGCAAACATAGCATTAGACTTTTGGGCTAGGTTGCTCAGACTCCTCAAAAATGTCG
TGTG

chr11 36,642,429 A A G
ACCATTTCAGCAGTATCTAGTCCC
AAGGGGGAGATCAATACCACC
24
21
24
58.86
80
CCGGCGGTATAACCTGGTTTTCATAATCATCAGAAACAGACTTTACATCAAATTTCTTCATAACTTGATAAGAAGACATTTGGCGTTGTTTGAACAAGAA
CTAGCTAGTTGAGTTAGTGCATACCACCATCCTCGGCATGTATCTCCCGAGGCAACTCACTCCTCTCCGTCTCCTAACTCTGAGTTTCCTTTCCAGCTGA
ATATCAAAACCATCATACAAACCCCATTGTTCGTCAATCTCTTGTCTAGTGCTAGTAATCACCATTTCAGCAGTATCTAGTCCCAACTCTTCTGCTTCT[
A/G]TTCTCCTCATTATCTTGTAGGTGGTATTGATCTCCCCCTTAGTGAGTCTGCCCTGTTTAAGCAATTGCTCGAACTTGTTTCTTCCTAGTGAGTGTC
CTGTTAACACCATTGGTACGTTTAAGGTTCCAGATAAGCGGGCTGCTACCTCTCCTGCATCAGCATAGTGCCCGTGAATTACATAAGGCCACACTGCTTT
TCCAGCATTGACTTGCTCCCCTATAGCCCTTGCCATATTCACAATGTGGCTTAATGCCCCATCAACAAATTCTGGTATGTAAGGCCAGAGTGATTCTTTT
GGAA

chr11 37,658,955 T T C
AACCCATAAGAGTGCGTGCT
CCTTGCATTTCCTTGTCACTCA
20
22
20
59.11
106
ATATTCTTCCTGATTCCCTTTCAATTTTAGATCAGTAATCAGACCTTCTAATCCCTTGTTTCTAGTTCCCTTGTTGCTGGTTACAATTTCTGTTTCCTCA
TCTTGCAGAATCTCTCAAACAACCAAAAGGATGCTTTAGCTGAGATAACAGATGTTCTGCGAGCAGTCTGCCATGCACATAAGCTGCCTCTTGCTCTGAC
ATGGATTCCCTGTAATGTCACTGAAGGAGAAGGAGATGAACCCATAAGAGTGCGTGCTAGAGGATGTAATACAAGTTTAAATGAAAAATGTGTATTATG[
T/C]GTTGAGGATACAGCTTGTTATGTGAGTGACAAGGAAATGCAAGGATTTGTACATGCATGTATGGAACATTTTCTCGAGGAAGGCGAAGGTATTGTT
GGGAAAGCTCTGCAATCTAACCATCCCTTCTTCTACCCTGATGTGAAGGAGTATCATATAAGTGAGTACCCACTTGTTCATCATGCACGAAAGTTTGGTC
TAAATGCTGCTGTGGCTATCAGATTACGTAGTACATTCACCGGCAATGACGATTATATATTGGAGTTCTTTCTTCCTACAAGTATGAAGGGAAGTACCGA
ACAA

chr11 43,360,731 T T C
TGTGCACTCATTACGACTGAGT
GCATGTGCGCTTTAGGGAAG
22
20
22
59.9
85
AAAGCTTGATAAACACTCAATAACATGCACAACTACAATTGATGCAACAAGTTCACACCCGACGTAGACTGAGTAACATGCTTAGCCCACAACTGATGTG
ACAGTCCATGACCGATCCGACAGTCTACAATTTATATCATCTAGCAGATATTTCTTGTCGTTGGCCAATGTGTCTTGACCGAAGCATATAGTCCTTAGAA
GAAGGTGTTTGCCGTTGGCATATGCTAATGTTACCTTGCTTATGTGCACTCATTACGACTGAGTCGTGCAATCTTAGGATGTTGCTTCATACCACTGCC[
T/C]AGCATCGCTTCCCTAAAGCGCACATGCCTTTGATGACGCTTCATGACATTGGCCAATGCAAATGTAGCCCTGTTGATGGACACACTCCATGTTTGA
TGCATGCAAGTCTTTTCTAGTAATGTGAGATGTGTACACACATTGATTGCTGCTTCTTGTCGTTTGTCTACATTTTTTTCCTAAAGACAAAAAGTCTTGG
TTTGTGGTGCCAACATTTCGCAGAAGACGATATCACTCAAGCGATGCACACATGCCACAGGCTATACATCTATTCCTTTGATGATGTTGCATGACATTTT
ACTA

chr12 25,090,414 G A G
GTATTGAGGATGATGATTTGCTCA
CCACCTCAAAAGATTAATAGTACG
24
24
24
55.38
80
CGATATGCTTAAAATCAGATGGAAGGAGTTGTATCCTTACATCACTCAGATTGTGCTTCTTGAGTCAAACTCAACATTTACGGGTTTGGCTAAACTCCAC
AATTTTGCACTTAATAGGGACCAATTTAAGTTCATTGAGCCTCGCTTGGCATATGGAAACATTGCCGGAAGAGATAAAAAAGGTGAAAATCCATTTGTTG
AAGAGGCATATCAGAGAGTAGCATTGGACCAACTTCTGAAACTTGCTGGTATTGAGGATGATGATTTGCTCATTATGTCCGACGTAGATGAGATTCCTA[
G/A]CGCTCGTACTATTAATCTTTTGAGGTGGTGCGATGACATTCCTCATGTCCTTCACCTTCATCTGAAGAATTACCTGTACTCATTTGAATTTCAGAT
TAAGCACAGAAGCTGGAGAGCTTCAGTCCACAGGTATCAGAGTGGTAAGACTAGATATGCACACTATCGTCAGAGTGATTACATTTTGGCGGATGCAGGT
TGGCATTGTAGCTTTTGTTTCCGCCACATTAGTGATTTTATATTCAAGATGAAAGCTTACAGCCACAGTGATAGAGTGAGGTTTTCACATTATCTGAACC
CTAC

chr12 35,201,546 C A C
ATGGGCTGACCTTCCTGTTG
GTACTCAGGCTGCCCGATTT
20
20
20
60.11
98
CAGCTTTATTGAGACAACCAGCCCGGTACTCCACTGTAAAATCATAATCCATGAGTTTACTCAACCAATGTTGTTGAGGTGGTGTAGTCAGCCATTGTTC
TAGCAATTATTTCAGGCTGTACTGATCTGTTCTGATAAGGAAAGGGCGCTCCCACAAGTATGGCCGCCAATGTTGTACTGCCTTTGCAAGGCCAATCAAC
TCCCTCTCATATGCAGCTAATTTTTGGTGACGAGCCGCTAGCTGTCGGCTAAAAAATGCTATGGGCTGACCTTCCTGTTGCATAACAGCCCCTATACCA[
C/A]CTCCTGAAGCATCACATTCTACAGTGAAATTCATAGTAAAATCGGGCAGCCTGAGTACTGGAGCAGAGGATAAGGCTTGCTGAAGCTTCTGGAATG
CATCAAGGGTCAGATCGCTCCATTGGAAGGAGTTTTTCTTAAGTAGACCAGTCAGAGGTGCTGCCAGTTGCCCATAGTCACGAATAAATTTGCGGTAGTA
ACCTGTCAATAACAAGAACCCACGAAGAGGTATAATTGATTGAGGTTGCGACTAATCCAGAATAACTTGTACTTTGCTCCTCTCTACTTCCACACCTGTA
ACTG

chr12 47,221,804 A G A
CTTGCTTGGATTGTTTCCTGGG
AGTAAGAAAAACTGAAGGGCT
22
21
22
55.03
80
CTGATCAGTAGCTGGTGTCACTTGACAAAGTATTTATGAATGTATGAAATTCATGAACAGGAATCTATGTTGGTGGAAGCAAAGTTGTTCATTTTACGCG
TGACCAAAGTATTGTTTCAGGGGACCAAATTCTCTTCTCTGCTCCCTTAAATTGCTCTTCAGCTTCGAGTACAAACGTGTCTTCAACCTGTACGAATATT
CCTGACTGTGGATTTCAACAAAAGGCAAGTGGTGTGGTTCTCTCTTGCTTGGATTGTTTCCTGGGTGAGGAGGGGCTATTGTACCGCTTTGACTATGGA[
A/G]CCAGCCCTTCAGTTTTTCTTACTAAACTTCGAGGTGGGACATGCACCACTGCACAATCTGATCCTCCAGAGGCAGTGATCCATAGAGCCATGTACT
TGCTTCAAAATGGTTTTGGAAATTATGATGTCTTCAAGAACAACTGTGAAGATTTTGCCTTGTACTGCAAAACAGGTCTTCTTGTTCTTGACCAAGGAGC
TCTTGGAAGGAGCGGTCAAGCTGCCTCTGTCATAGGTGCTCCTTTGGCAGCTATTGCCTCGTCGCCTCTGAAGTTATTCATGACAAGTCCAGCTGGCTTA
GTCG

chr12 63,101,436 T C T
CACCTACGACATCTGCCCAC
TGCATGTTTTCATTGGTAAACA
20
22
20
55.36
91
GACGCGTTGTCACTGTGAAGATGTTGGAGGAGACTTACGATGGTGTTCATGCCAAATTGCACATACATCACGACTATACCAACATACTTACTATCTCTCT
CCAGTATCGGTGAGAAGAAATCATCTAGTTGGAGGGGACTCATCGTCTGGAGGCACAGATGACCCAAAATCAATGTTTGGATACACACCAGGAGGTTGTT
CTCGAGGTTGTATAGAGAATAATTGACTTGAATCACCTACGACATCTGCCCACCCGTAGTGAGGCTCAGCCCTTCAATCATAAGTAAGACGTTTTACTT[
T/C]GATGTTTACCAATGAAAACATGCAAACATAGATGACATTCACTTACTCGTAGTACGTTTTTTCATCCACAACCATGTCCCAGCTTTCACCAGTTGT
GCTCTTGCCATATTTGTGTACCTTGCTGATTGAGGAACAAAGGGGCATACCATGAGTCTTTTTTATATTATCATTTGGGTTTCAAAGAGGAAAACTTAGC
GAGGAAATCAATATGCAACTTGCAAAATATCATAGAACGCGATGAAACATTGAATGTATAGTCATAAAATTACCCATTTCCAAAGTGCTCCTCTCCCCAT
GTCC

chr12 63,143,568 A C A
ACGATTCGTGCATTGAAACCA
GCAAACTCTCAGGAAGGAACG
21
21
21
59.2
91
CTGTTGTCCATGAACGTGGAAGCCCCGAGTCTATCAGGGACATTCGTGGTTTTGCTGTCAAGTTCTACACCAGAGAGGTAATTTCGTGTTAATTACTTGA
ACATGAACTTAGGTCACGGAATCTTTGATTGGGTTTTTTGTTTAAAATGTAATGTTTTGAATTGATTGACTCAGGGTAACTTTGATCTTGTTGGAAACAA
TGTCCCCGTGTTCTTTAATCGTGATGCTAAGTCGTTCCCTGACACGATTCGTGCATTGAAACCAAATCCAAAGTCACACATTCAGGAGAACTGGAGGAT[
A/C]CTTGATTTCTTCTCGTTCCTTCCTGAGAGTTTGCATACATTCGCCTTCTTCTACGATGATGTTTGTCTCCCAACGGATTACAGACACATGGAAGGT
TTTGGCGTTCACGCGTATCAATTGATTAACAAAGAGGGGAAAGCACATTATGTGAAGTTCCACTGGAAGCCAACTTGTGGTGTGAAATGTATGTCTGAGG
AAGAAGCTATTAGAGTCGGTGGTACTAATCATAGCCACGCGACCAAGGATCTTTACGATTCAATTGCTGCTGGAAACTATCCTGAGTGGAAGCTTTTTAT
CCAA

chr12 63,319,518 C T C
TCATACTGCAATTACCCACAA
TCCTCATCTGTATCATTAGTTGCT
21
24
21
57.26
80
ACAGCCTCAACCACTCTCATCACAATCACATCCATACAGTAATATTTACAGAAGTAGCAATAAAGACCATATTGCTACAGTGTACCTCACAATGTTTCCA
TGCTGCATCTCTTTCAAGAGGGAGATTTCTCTAATAGCCGTGCTTGGCACACCCTCGTCTTCCTGCTCCAGCCGAATTTTCTTCAGTGCAATAGTTTCAT
TAGTTACACGATCACGAGCTTTGTACACTACGCCGTACGTTCCTTCACCAATCTTTTCAACTTTTTCATACTGCAATTACCCACAATATCACTTTCCAA[
C/T]ATAAGCATCAGGTAAACAGAAAGCAACTAATGATACAGATGAGGAACTCCTTACCTGGTCCATCTTAGGTCAAACTGGATGGACTCCTGAAAGGCA
AAGCAAGAGGAACAAAAAGGAAATTCAGATGAAAAGTAGTGAGAAAGAAAATTTGACACAGATACCTTTTAAGTCATTTTGATTAAGATCAAGTGCATTA
TCTGTTTTTCAATCAATTTCTTTTTAGATGGATCAACATTCAGTTCAAAGTTGCCACTACTAAATAGGAGCAGCGTAAAGGGGAAAACGCCAGAAATCCC
ACTC





logout